ID: 1184923252

View in Genome Browser
Species Human (GRCh38)
Location 22:47620419-47620441
Sequence CGCAGGCTGTCTTCGACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184923252_1184923258 7 Left 1184923252 22:47620419-47620441 CCAACAGTCGAAGACAGCCTGCG No data
Right 1184923258 22:47620449-47620471 GGTCATTCCTTCCCTCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184923252 Original CRISPR CGCAGGCTGTCTTCGACTGT TGG (reversed) Intergenic
No off target data available for this crispr