ID: 1184924165

View in Genome Browser
Species Human (GRCh38)
Location 22:47625835-47625857
Sequence TGGTGGGTATGGAGGGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184924165_1184924181 25 Left 1184924165 22:47625835-47625857 CCCTTGTCCCTCCATACCCACCA No data
Right 1184924181 22:47625883-47625905 CTCCCTGCAGCGACCCTTGATGG No data
1184924165_1184924184 30 Left 1184924165 22:47625835-47625857 CCCTTGTCCCTCCATACCCACCA No data
Right 1184924184 22:47625888-47625910 TGCAGCGACCCTTGATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184924165 Original CRISPR TGGTGGGTATGGAGGGACAA GGG (reversed) Intergenic
No off target data available for this crispr