ID: 1184924195

View in Genome Browser
Species Human (GRCh38)
Location 22:47625930-47625952
Sequence GTGGGAGTATGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184924195_1184924208 23 Left 1184924195 22:47625930-47625952 CCCTCTGCCCTCCATACTCCCAC No data
Right 1184924208 22:47625976-47625998 AGTCCACGTCTTGCTCCCTGTGG No data
1184924195_1184924204 0 Left 1184924195 22:47625930-47625952 CCCTCTGCCCTCCATACTCCCAC No data
Right 1184924204 22:47625953-47625975 CCACCAGAGCACCATCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184924195 Original CRISPR GTGGGAGTATGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr