ID: 1184924686

View in Genome Browser
Species Human (GRCh38)
Location 22:47629105-47629127
Sequence GCATGTGCATGTGTGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184924679_1184924686 12 Left 1184924679 22:47629070-47629092 CCGTGTGTGTGCTCACCAGGGAC No data
Right 1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG No data
1184924683_1184924686 -3 Left 1184924683 22:47629085-47629107 CCAGGGACTGGCCCATGGGTGCA No data
Right 1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184924686 Original CRISPR GCATGTGCATGTGTGTGATG TGG Intergenic
No off target data available for this crispr