ID: 1184924835

View in Genome Browser
Species Human (GRCh38)
Location 22:47629789-47629811
Sequence CCCAAGGAAGGACCTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184924835_1184924842 1 Left 1184924835 22:47629789-47629811 CCCTGGGCAGGTCCTTCCTTGGG 0: 1
1: 0
2: 1
3: 36
4: 392
Right 1184924842 22:47629813-47629835 TCGCCTCTGTAGGATTGAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
1184924835_1184924840 -9 Left 1184924835 22:47629789-47629811 CCCTGGGCAGGTCCTTCCTTGGG 0: 1
1: 0
2: 1
3: 36
4: 392
Right 1184924840 22:47629803-47629825 TTCCTTGGGGTCGCCTCTGTAGG 0: 1
1: 0
2: 0
3: 12
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184924835 Original CRISPR CCCAAGGAAGGACCTGCCCA GGG (reversed) Intergenic
900494915 1:2971999-2972021 GCCCAGGAAGGTGCTGCCCACGG + Intergenic
900576261 1:3383960-3383982 CCCAAGGACACACTTGCCCAAGG + Intronic
900775941 1:4585530-4585552 CCAAAGGAAGGACTTTCCAAAGG + Intergenic
900821826 1:4895717-4895739 CCTCAGGAAGAACCTGCCAATGG + Intergenic
900901483 1:5519485-5519507 CACAGGGATGGAGCTGCCCAAGG - Intergenic
901469785 1:9448392-9448414 CCCTGAGAAGGAACTGCCCAGGG + Intergenic
901805785 1:11737648-11737670 CCCCAGAAAGGACCTGGCCCTGG - Intronic
901878674 1:12181393-12181415 CCCAAGTGAGGACCTCCCCAGGG + Intronic
902689787 1:18103419-18103441 CCCCAGGCAGGCCCTGCCCCAGG - Intergenic
903448496 1:23437263-23437285 CCCGAGGAAGGCGCTGCTCAGGG + Exonic
904289265 1:29473666-29473688 CCCCAGGAAGGGCCTGCAGATGG - Intergenic
904375181 1:30076594-30076616 CACAAGGATGGAGCTGCCCAAGG + Intergenic
904623391 1:31788926-31788948 CCAAAGGAAATCCCTGCCCAGGG + Intergenic
905231648 1:36518208-36518230 CACTAGGAAGGACTTCCCCAAGG + Intergenic
905296311 1:36956517-36956539 CCCAAGAAAACAGCTGCCCAGGG + Intronic
906108151 1:43306960-43306982 CCGAAAGAAGGCGCTGCCCAGGG - Exonic
906894730 1:49758477-49758499 GCCTATGAAGGAACTGCCCAGGG + Intronic
906992648 1:50755417-50755439 CACAAGGGCGGAGCTGCCCAAGG - Intronic
907787094 1:57623237-57623259 CCCACGGAAGGAGTGGCCCAGGG + Intronic
908094428 1:60721867-60721889 CACAGGGATGGAGCTGCCCAAGG + Intergenic
908171701 1:61511476-61511498 CCCAAGGGAGGCCATCCCCAGGG - Intergenic
908700485 1:66894153-66894175 CCCACTAAAGGACCTGCCCGAGG - Intronic
911082745 1:93949799-93949821 CACAAGGGTGGAGCTGCCCAAGG - Intergenic
911511154 1:98809066-98809088 CACAGGGGAGGAGCTGCCCAAGG - Intergenic
911829861 1:102536905-102536927 CACAGGGGAGGAGCTGCCCAAGG - Intergenic
912052010 1:105541588-105541610 CACAGGGGAGGAGCTGCCCAAGG - Intergenic
912192038 1:107352048-107352070 CACAAAGATGGAGCTGCCCATGG - Intronic
912459703 1:109822473-109822495 CCCAAGGAAGGGACAGCTCATGG - Intergenic
913112969 1:115672437-115672459 CCCGAGGAAGAGCCTTCCCATGG + Intronic
915490645 1:156248261-156248283 CCCAAGGCAGGATGTGGCCATGG + Intergenic
915559960 1:156681381-156681403 CTCAAGGCAGGGCCTGCCAAAGG + Intergenic
915677749 1:157547366-157547388 CCCAAGGGAGAAATTGCCCAGGG + Intronic
916296697 1:163227966-163227988 CACAGGGATGGAGCTGCCCAAGG - Intronic
916876432 1:168974434-168974456 CCCAAGGAATAACCTCTCCATGG - Intergenic
918897477 1:190366891-190366913 CACAGGGATGGAGCTGCCCAAGG - Intronic
918920179 1:190698707-190698729 CACAAGGACGGAGCTGTCCAAGG + Intergenic
919482592 1:198108131-198108153 CCCAAGGAAAGACTTGGCCCAGG + Intergenic
919731658 1:200916753-200916775 CCCAGGGGATGACCTGTCCAAGG + Intergenic
919815682 1:201437208-201437230 CCCAAGGAACAGCCTGGCCACGG + Intergenic
920250633 1:204620086-204620108 CCCAAGGAACCACCCTCCCAGGG + Exonic
921465031 1:215477304-215477326 CACAGGGATGGAGCTGCCCAAGG - Intergenic
922501704 1:226101827-226101849 CCTCCCGAAGGACCTGCCCAAGG - Intergenic
922757822 1:228106266-228106288 CCCAGGGAAGGTCCTGCCCTGGG - Intergenic
922757823 1:228106266-228106288 CCCAGGGCAGGACCTTCCCTGGG + Intergenic
923143220 1:231179179-231179201 GACCAGGAAGGACCTGCCCCAGG + Intronic
1063189906 10:3683618-3683640 CCCAAGGAAGGGCTTGCTCCAGG - Intergenic
1065527496 10:26637961-26637983 CCCAAGGCAGGGCCTGTGCAGGG + Intergenic
1065559344 10:26946427-26946449 CCCCAGGCAGGGCCTGCGCAGGG - Intergenic
1066623493 10:37382313-37382335 CCCAAGGAGGCACCTCCTCAGGG + Intronic
1067062964 10:43087411-43087433 ACCAGGGAAGGAGCTGCCCTTGG + Intronic
1069615493 10:69803630-69803652 GCCATGGAAGGTCCTGGCCATGG + Intronic
1070696266 10:78565736-78565758 GCCAAGGAGGTACCTGCCAAGGG + Intergenic
1070781231 10:79138438-79138460 CCCAAAGGAGGGCCAGCCCAAGG - Intronic
1070784943 10:79157509-79157531 CCGGAGCAAGGACCTCCCCATGG - Intronic
1071599895 10:86953972-86953994 GCCAAGGGAGGGCCTGCCCAGGG - Intronic
1071978680 10:90981267-90981289 CCTCCTGAAGGACCTGCCCAAGG - Intergenic
1072866440 10:99067157-99067179 CACAAGGACAGAGCTGCCCAAGG - Intronic
1073513393 10:104056790-104056812 CCCCAGGAGGTACCTGGCCAAGG - Intronic
1074894693 10:117765116-117765138 ACCAAGGGAGGGCATGCCCAGGG - Intergenic
1075402588 10:122171841-122171863 CTCATGGAAGGGCCTGGCCAAGG - Intronic
1075515506 10:123104905-123104927 GCCCAGGAATGACCTGTCCAAGG + Intergenic
1075719747 10:124577759-124577781 CCCAAGGAAGGCCTTCCCCTGGG - Intronic
1076737861 10:132466780-132466802 CCCAAGGCAGGCTCTGCCCCTGG + Intergenic
1077035892 11:494323-494345 CACAGGGCAGGCCCTGCCCAGGG - Intergenic
1077416066 11:2424872-2424894 CCCCAGGCAGGACCCACCCACGG + Intergenic
1077673945 11:4181307-4181329 CCAAATGAGGGACCTGGCCAGGG - Intergenic
1077774799 11:5258863-5258885 GCCACAGAAAGACCTGCCCAAGG + Intronic
1078031430 11:7755385-7755407 TACAATGAAGGACCTGCCCAAGG - Intergenic
1080824617 11:35837446-35837468 CCTTAGAAAGGAACTGCCCATGG + Intergenic
1082118965 11:48357576-48357598 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1082255333 11:50027573-50027595 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1082827058 11:57587576-57587598 CACAGGGGAGGAGCTGCCCAAGG + Intergenic
1083330658 11:61896967-61896989 CCCAGGGGAGGACCTGGCCAAGG + Intergenic
1084065131 11:66699659-66699681 CCCTAGGAGGGACCCACCCAGGG + Intronic
1084858581 11:72003997-72004019 CTCAAAGAAGGCCCTGTCCAAGG - Exonic
1085012454 11:73150663-73150685 CCTAAGGGAGGATGTGCCCAAGG + Intergenic
1085470228 11:76752935-76752957 CCCAGCGGAGGAGCTGCCCAAGG - Intergenic
1087718234 11:101633002-101633024 CGCAAGGAATGGCCTGCCAAGGG + Intronic
1087938366 11:104062273-104062295 TCCCAGGAAGAACTTGCCCAAGG - Intronic
1087941625 11:104103919-104103941 CCCCTTGAAGGACCTGCCTAAGG - Intronic
1090785399 11:130043797-130043819 CCCCAGGCTGGAGCTGCCCAAGG + Intergenic
1092060846 12:5549047-5549069 ACCAGGGAAGGGCATGCCCAGGG + Intronic
1092063234 12:5567521-5567543 CCCAGGGAAGGATTTCCCCATGG - Intronic
1094475540 12:30837876-30837898 CCCATAGATGGAGCTGCCCAGGG - Intergenic
1094526402 12:31234048-31234070 CCAAAGGAATGACCTCCCAAAGG - Intergenic
1095252786 12:39998422-39998444 CACAAGGGTGGAGCTGCCCAAGG + Intronic
1095268919 12:40193494-40193516 ACCAAAGAAGAATCTGCCCATGG + Intergenic
1095640828 12:44483290-44483312 CACAAGGGTGGAGCTGCCCAAGG - Intergenic
1096972968 12:55682210-55682232 CCCAAGGAAGGTCCTGCAGGAGG + Exonic
1097302702 12:58035496-58035518 CACAGGGGAGGAGCTGCCCAAGG - Intergenic
1097618119 12:61907773-61907795 CACAAGGGTGGAGCTGCCCAAGG + Intronic
1098784835 12:74739489-74739511 CCCAAAGAAGATCATGCCCAGGG - Intergenic
1099905083 12:88761818-88761840 GCCAGGAAAGGAGCTGCCCAAGG - Intergenic
1100028782 12:90161537-90161559 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1100230264 12:92599991-92600013 CACAGGGATGGAACTGCCCAGGG - Intergenic
1101753275 12:107600917-107600939 AGCAAGGAAAGACCTGCCCTGGG + Intronic
1103532645 12:121613007-121613029 ACCAGGGAAGGACATGCCCCAGG + Intergenic
1105686901 13:22793001-22793023 CCTAAGGAAGGTCCCGCCCCAGG - Intergenic
1105779124 13:23690939-23690961 CCTGGGGAAGGACCTGCTCATGG - Intergenic
1106539149 13:30674429-30674451 CCCAGGGGAGAACCTGCCAAGGG + Intergenic
1106864492 13:33948651-33948673 CACAAGGGTGGAGCTGCCCAAGG + Intronic
1107106180 13:36645324-36645346 GCCTAGAAAGGACCTGGCCAAGG + Intergenic
1107472485 13:40703587-40703609 CCAAAGGGAGGAGGTGCCCAAGG + Intergenic
1108968466 13:56341862-56341884 CACAAGGAAAGAGCTGCCAAAGG - Intergenic
1110970423 13:81754321-81754343 CACAGGGAGGGAGCTGCCCAAGG + Intergenic
1111163796 13:84430621-84430643 TCCAAGGAATGACATGCCCCGGG + Intergenic
1111222347 13:85220902-85220924 ACCCATGAAGGAGCTGCCCACGG + Intergenic
1111227058 13:85288310-85288332 CACAGGGAAGCAGCTGCCCAAGG - Intergenic
1111778693 13:92694417-92694439 CACAGGGGAGGAGCTGCCCAAGG + Intronic
1113087821 13:106586100-106586122 GCCCATGAAGGAGCTGCCCAAGG + Intergenic
1113133043 13:107059787-107059809 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1113865137 13:113516983-113517005 CACAGGGCAGGCCCTGCCCACGG - Intronic
1114448231 14:22806467-22806489 CCCAAAGAAGGCGCTGCTCATGG + Intronic
1114568545 14:23649666-23649688 CCCAAGGAAGCACATGTGCATGG - Intergenic
1114984599 14:28210702-28210724 CACAAGGGTGGAGCTGCCCAAGG + Intergenic
1118070953 14:62246074-62246096 CACAGGGGAGGAGCTGCCCAAGG + Intergenic
1118151488 14:63195225-63195247 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1118742337 14:68748675-68748697 CCCAAGGAAGAAGCTGCAGAAGG + Intergenic
1122320000 14:100849469-100849491 AGCCAGGAAGGAGCTGCCCATGG + Intergenic
1122517429 14:102318846-102318868 CCCAAGGAGGAAACTTCCCAAGG - Intronic
1122960703 14:105092591-105092613 CCCAAGGAAGGATCTCGCCCGGG + Intergenic
1122984939 14:105207696-105207718 GCCCAGGCAGAACCTGCCCAAGG + Intergenic
1124509012 15:30306525-30306547 CCCAGGGGTGGAACTGCCCAAGG - Intergenic
1124556022 15:30726789-30726811 CACAGGGATGGAGCTGCCCAAGG - Intronic
1124675252 15:31678982-31679004 CACAGGGATGGAGCTGCCCAAGG + Intronic
1124734545 15:32232137-32232159 CCCAGGGGTGGAACTGCCCAAGG + Intergenic
1126103163 15:45131570-45131592 CCCAAGCAGGGCCCTGCCTAAGG + Exonic
1127308153 15:57728220-57728242 CCAAAGGAAGGGTCCGCCCAGGG - Intronic
1127804600 15:62507440-62507462 CCCAAAGAAGGACCAGCCTTAGG - Intronic
1127855900 15:62953442-62953464 CCCCAGGAAGTACCTTCCCAGGG + Intergenic
1128494484 15:68186137-68186159 CCCACTGAAGGACCTGCCTGAGG - Intronic
1129274439 15:74435764-74435786 GACAAGGACGGACCTGCCCGAGG + Intergenic
1129620244 15:77137432-77137454 CACAGGGATGGAGCTGCCCAAGG + Intronic
1129869181 15:78929817-78929839 GCCTGGGAAGCACCTGCCCAGGG - Intronic
1130396017 15:83502286-83502308 CCCAAGGAAGGTGCTGCTGATGG - Intronic
1130409271 15:83631201-83631223 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1131427082 15:92354485-92354507 GCCCATGAAGGAGCTGCCCAAGG + Intergenic
1132310995 15:100858077-100858099 CCCAAGAAAGGACCTGGCCCAGG + Intergenic
1132738442 16:1398871-1398893 CCCAAGGGTCGCCCTGCCCAGGG - Exonic
1133219153 16:4311489-4311511 CCCCTGCAAGGTCCTGCCCAGGG - Intergenic
1134451762 16:14368179-14368201 CCCAGAGATGGGCCTGCCCAGGG + Intergenic
1134504287 16:14792408-14792430 CCCAATACAGGACCTGCCCAGGG - Intronic
1134576286 16:15336501-15336523 CCCAATACAGGACCTGCCCAGGG + Intergenic
1134726156 16:16420001-16420023 CCCAATACAGGACCTGCCCAGGG - Intergenic
1134941278 16:18291859-18291881 CCCAATACAGGACCTGCCCAGGG + Intergenic
1135527282 16:23223512-23223534 CCCAAGGCAGGACAGGCCCAGGG + Intergenic
1136175635 16:28514486-28514508 CCCAGGACAGGCCCTGCCCAGGG + Intergenic
1139172717 16:64650527-64650549 CACAAGGGAAGAGCTGCCCAAGG - Intergenic
1141198350 16:81878383-81878405 TCCAAAGAAGGTCATGCCCATGG + Intronic
1141860397 16:86712384-86712406 GCCAAGGAAACTCCTGCCCAGGG - Intergenic
1142177040 16:88650180-88650202 CTCCAGGAAGGACCTGCACCGGG - Intronic
1142496106 17:307072-307094 CCCATGGCAGGTCCTCCCCACGG + Intronic
1142496127 17:307136-307158 CCCATGGCAGGTCCTCCCCATGG + Intronic
1142496160 17:307232-307254 CCCACGGCAGGTCCTCCCCACGG + Intronic
1142496181 17:307296-307318 CCCACGGCAGGTCCTCCCCACGG + Intronic
1142496187 17:307312-307334 CCCACGGCAGGTCCTCCCCACGG + Intronic
1143690876 17:8564416-8564438 CCCAAGGCCTGGCCTGCCCACGG + Intronic
1145272099 17:21410198-21410220 CTCATGGCAGGCCCTGCCCAGGG - Intronic
1145768943 17:27478803-27478825 CCCAGGAGGGGACCTGCCCAGGG - Intronic
1146593134 17:34146093-34146115 CCCAAAGAAAGCCCTTCCCAAGG - Intronic
1146916114 17:36679513-36679535 CCCAAGCAAGGACTCTCCCAGGG - Intergenic
1149560860 17:57606988-57607010 TCTAAGGAATGACTTGCCCAAGG - Intronic
1149871160 17:60183128-60183150 CCCAAGAAAGCACCTGCATAAGG + Intronic
1150485663 17:65541710-65541732 CACAGGGAAGGACCCACCCAAGG + Intronic
1151915024 17:77111529-77111551 CACAGGGATGGAGCTGCCCAAGG + Intronic
1152241395 17:79163197-79163219 CCCAAGGAGGGAGCTGGCCAAGG - Intronic
1152340331 17:79720847-79720869 CGCAGGGCAGGCCCTGCCCAAGG + Intergenic
1152548126 17:81013261-81013283 CCCGAGGGCGGAGCTGCCCAAGG + Intergenic
1154058029 18:11030471-11030493 CCAAAGGAGTGACTTGCCCAAGG + Intronic
1154269024 18:12903320-12903342 CCCCCTGAAGGACCTGCCTAAGG - Intronic
1156322388 18:36038720-36038742 TCCCATGAAGGAGCTGCCCAAGG + Intronic
1156622074 18:38864479-38864501 CACAAAGGAGGAGCTGCCCAAGG + Intergenic
1157202277 18:45669151-45669173 CCCAGGGAAAGACCTGCTCAGGG + Intronic
1158465722 18:57688230-57688252 TCCAAGTAATGACCTGCACACGG + Intronic
1160720756 19:596002-596024 CCCAGGGGAGGGCCTGCCCAGGG - Intronic
1161292995 19:3505921-3505943 CCCTAGGAAGGGTCTGCCCTGGG + Intergenic
1161356713 19:3823191-3823213 GTCAGGGAAGGACCTTCCCATGG - Intronic
1162115501 19:8426861-8426883 CCAAAGGCAGGAGCTGCCCCGGG + Intronic
1162489532 19:10984185-10984207 CCCGGGGAAGGACCTGGCCGAGG - Exonic
1162790720 19:13061357-13061379 ACCAAGGAAGGAGCTGCCCGTGG - Intronic
1162849845 19:13422527-13422549 CCAAAGGAAGGACTGGCCCTTGG + Intronic
1163688679 19:18726412-18726434 CCCAAGGAAGCAGATGCCCATGG - Intronic
1164694792 19:30235173-30235195 CCCAAGGGAGGCCCTTCCCTGGG - Intronic
1164850876 19:31483168-31483190 CACAAGGGTGGAGCTGCCCAAGG - Intergenic
1166045116 19:40225423-40225445 CCCAAAGAAAGATCTGACCAAGG + Intronic
1166696898 19:44856977-44856999 TCCAGGGAAGGACTTGCTCATGG - Intronic
1166944033 19:46386269-46386291 CACAGGGGAGGCCCTGCCCATGG + Intronic
1168319615 19:55501080-55501102 CTCAAGAGAGGACCTGGCCAAGG + Exonic
925141737 2:1555247-1555269 CTCCAGGAAAGAGCTGCCCATGG + Intergenic
925291988 2:2754154-2754176 CACAGGGATGGAGCTGCCCAAGG + Intergenic
927552309 2:24010636-24010658 CTCAGGGAAGGTCCTGGCCATGG + Intronic
927706865 2:25301791-25301813 CCCAAGGAGGGGCCAACCCAGGG + Intronic
929994838 2:46818750-46818772 ACTAAGGAAGGACCTGGGCAAGG - Intronic
932464432 2:71907231-71907253 CCCAAGGTAGGACCAGCCCGAGG - Intergenic
933778848 2:85787741-85787763 TCCATGGCAGGGCCTGCCCATGG - Exonic
933847675 2:86338326-86338348 CCCAAGGAAAGGCCTTCCCTAGG - Intergenic
934184408 2:89658794-89658816 TTCAAGGAAGGAGCTGGCCACGG - Intergenic
934294693 2:91732932-91732954 TTCAAGGAAGGAGCTGGCCACGG - Intergenic
934476434 2:94596549-94596571 GCCAGGGAGAGACCTGCCCAAGG - Intronic
935294927 2:101640568-101640590 CCTAAGGAAGAACCTGCTTAAGG - Intergenic
935830524 2:106996942-106996964 CCAAAGGAAGGACCTTCCAGTGG - Intergenic
937241331 2:120464491-120464513 CCCCAGGAAGGACAATCCCATGG + Intergenic
937267345 2:120624878-120624900 CACAAGGAAGGAAGTGCTCATGG + Intergenic
937356888 2:121203289-121203311 TCAGAGGAAGGACCTGCCCTTGG - Intergenic
937380805 2:121374613-121374635 CACAAGGGTGGAGCTGCCCAAGG + Intronic
937494397 2:122402617-122402639 CCCAGGGAGTGACCTGGCCAAGG + Intergenic
938131321 2:128717941-128717963 GCCAAGGAAGGACCAGAGCAGGG + Intergenic
938562732 2:132489127-132489149 CCCCAGGAAGTACCTTCGCAGGG - Intronic
945515823 2:210762489-210762511 CACAGGGAAAGAGCTGCCCAAGG - Intergenic
946562161 2:220925936-220925958 CACAAGGATGGAACTGCCCAAGG - Intergenic
946995346 2:225384553-225384575 CACAAGGGTGGAGCTGCCCAAGG + Intergenic
948221073 2:236270126-236270148 CACAAGGGTGGAGCTGCCCAAGG + Intergenic
948468400 2:238162942-238162964 CCCAAGGAGGCACCTGCTCTGGG + Intronic
948976232 2:241465351-241465373 CCCAGGGCAGGACCTGTTCAGGG + Intronic
1169203976 20:3729986-3730008 CAGAAGGCAGGACGTGCCCAAGG + Intergenic
1170569520 20:17625036-17625058 CCCAAGGCAGGCCCTGGCCTTGG - Intronic
1170809468 20:19662376-19662398 CACCAGGCAGGACCTGCCCCTGG + Intronic
1171818670 20:29812484-29812506 CACAAGGTAGAACCTTCCCAAGG - Intergenic
1173563495 20:44022777-44022799 ACGAAGGCAGGTCCTGCCCATGG - Intronic
1173848269 20:46201516-46201538 GCCAAGGAGTGACTTGCCCAAGG - Intronic
1174372280 20:50099585-50099607 CCCACGCAAGGACCTACCCAGGG + Intronic
1175579929 20:60090523-60090545 CCCAAGTAAGAAGCTACCCAAGG - Intergenic
1175580035 20:60091410-60091432 CCCAAGTAAGCAGCTACCCAAGG - Intergenic
1175964809 20:62655230-62655252 CCCCGGGAAGGACCCTCCCAGGG + Intronic
1175964827 20:62655286-62655308 CCCCGGGAAGGACCCTCCCAGGG + Intronic
1175964845 20:62655342-62655364 CCCCGGGAAGGACCCTCCCAGGG + Intronic
1176095760 20:63343683-63343705 CCCAGTGAAGGCCCTGGCCAGGG - Intronic
1176342699 21:5713451-5713473 ACCAGGGAATGTCCTGCCCAGGG + Intergenic
1176474953 21:7145602-7145624 ACCAGGGAATGTCCTGCCCAGGG + Intergenic
1176502128 21:7611005-7611027 ACCAGGGAATGTCCTGCCCAGGG - Intergenic
1176537020 21:8111520-8111542 ACCAGGGAATGTCCTGCCCAGGG + Intergenic
1177085194 21:16694754-16694776 CACAGGGATGGAACTGCCCAAGG - Intergenic
1177318376 21:19490669-19490691 CCCAAGGCTGGACCGGCTCAAGG + Intergenic
1178300436 21:31448649-31448671 CCCAAGGAAGGTGCTGAGCATGG + Intronic
1178397180 21:32252994-32253016 ACTAAGGAAGGAGCTGCCCTTGG + Intergenic
1178894056 21:36544199-36544221 CCAGGGCAAGGACCTGCCCAAGG - Intronic
1179515304 21:41902448-41902470 TAAAAGGAAGGACCTGCTCATGG - Intronic
1179565804 21:42247907-42247929 CGCAAGGAAGGACCCTCCCCTGG + Intronic
1180322115 22:11331858-11331880 CACAAGGTAGAACCTTCCCAAGG - Intergenic
1180332798 22:11547844-11547866 CACAAGGTAGAACCTTCCCAAGG + Intergenic
1181165288 22:20979912-20979934 CCCAGGGAAGGACCTACCCCAGG - Intronic
1182258442 22:29054750-29054772 CCCAAGGAAGCAGCAGCCAAGGG - Exonic
1182427535 22:30282847-30282869 CCCAGGGAGGGGCCTGCCCACGG - Intergenic
1182777244 22:32840027-32840049 CCCCAGGACAGACCTGCCCTGGG + Intronic
1182990923 22:34766754-34766776 GCCAAGAAATGACCTGGCCAGGG + Intergenic
1183441492 22:37825420-37825442 CCCAGGGAGGGACCCGTCCACGG + Exonic
1183648503 22:39140546-39140568 CCAGAGCAAGGACCTGGCCAGGG - Intronic
1184477949 22:44731598-44731620 CCCCTGGCAGCACCTGCCCAAGG - Intronic
1184924835 22:47629789-47629811 CCCAAGGAAGGACCTGCCCAGGG - Intergenic
1185129717 22:49032151-49032173 CCCAGGGAAGCATCTGCCTAGGG - Intergenic
1203241971 22_KI270733v1_random:27924-27946 ACCAGGGAATGTCCTGCCCAGGG + Intergenic
949128209 3:471304-471326 CACAAGGGTGGAGCTGCCCAAGG + Intergenic
950653280 3:14421124-14421146 CCGAAGGCAGGAGCTCCCCAGGG - Intronic
951573274 3:24087953-24087975 CCCAGGGAAGGACAAGCTCATGG + Intergenic
952738543 3:36713783-36713805 TCCAACTACGGACCTGCCCATGG - Exonic
953446691 3:42974494-42974516 CACAGGGATGGAGCTGCCCAAGG + Intronic
953544479 3:43854229-43854251 ACCAAGACAGGAGCTGCCCAAGG - Intergenic
953789899 3:45939310-45939332 CCCAAAGGAGGACATACCCAAGG + Intronic
953931659 3:47008804-47008826 CCCAGGGCAAGACCTCCCCATGG - Intronic
954337834 3:49929964-49929986 CCCGGGTCAGGACCTGCCCACGG - Exonic
956131230 3:66055690-66055712 CCCACGGAAGGAGTTCCCCATGG - Intergenic
957087828 3:75698964-75698986 CACAAGGTAGAACCTTCCCAAGG + Intergenic
957205599 3:77194377-77194399 CCAAAGAAAGGAGCTGCCAAAGG - Intronic
957711003 3:83859713-83859735 CACAGGGATGGAGCTGCCCAAGG - Intergenic
957876520 3:86154061-86154083 CCTAAGGAAGTACATGCCCTTGG + Intergenic
958955101 3:100458485-100458507 CACAGGGATGGAGCTGCCCAAGG - Intergenic
959245569 3:103863210-103863232 CACAGGGATGGAGCTGCCCAAGG + Intergenic
959756968 3:109910825-109910847 CCCACAGCAAGACCTGCCCAAGG - Intergenic
961019731 3:123495472-123495494 CCCAAAGAATCACCTGCCCTGGG - Intronic
961994284 3:131224599-131224621 CCTCCCGAAGGACCTGCCCAAGG - Intronic
962234713 3:133698043-133698065 CCCTATGAAGGACTGGCCCATGG - Intergenic
962312710 3:134337478-134337500 CCCCAGGGTGGAGCTGCCCATGG + Intergenic
962509546 3:136084695-136084717 CACAGGGGTGGACCTGCCCAAGG + Intronic
964849867 3:161083816-161083838 CCTCCTGAAGGACCTGCCCAAGG + Intergenic
965264978 3:166531654-166531676 CACAGGGATGGACCTGTCCAAGG - Intergenic
965973880 3:174596843-174596865 CCAAAGGAATGCCTTGCCCATGG + Intronic
966972870 3:185061291-185061313 CACAGGGATGGAGCTGCCCAAGG + Intergenic
967469601 3:189846487-189846509 TCCCAGGAAGCACCAGCCCATGG - Intronic
968734541 4:2288530-2288552 CCCATGGCAGGACCTCCCCTTGG - Intronic
969636718 4:8373783-8373805 CCCAAGGAATGTGCTGCTCAGGG + Intronic
969855372 4:9994900-9994922 CCCAAGCCAGACCCTGCCCATGG - Intronic
970057722 4:11994191-11994213 CACAAGGACAGAGCTGCCCAAGG + Intergenic
970712082 4:18875823-18875845 GCCAGAGAAAGACCTGCCCATGG + Intergenic
971126470 4:23760619-23760641 CACAGGGGAGGAGCTGCCCAAGG - Intronic
971871220 4:32241647-32241669 CCCAAAGACAGACCTGCTCATGG + Intergenic
972094637 4:35333931-35333953 GCCTGGGAAGGAGCTGCCCAAGG - Intergenic
976070164 4:81231730-81231752 CACAAGGGTGGATCTGCCCAAGG + Intergenic
976221627 4:82760851-82760873 CCCAAGGAAGGGCCTGTGCCTGG + Intronic
977912464 4:102553735-102553757 TCCAAGGAGGGCCCTGCCCTGGG - Intronic
978990499 4:115076119-115076141 CACAAGGATGTACCTGTCCAAGG + Exonic
980560059 4:134460696-134460718 CACAGGGACGGAGCTGCCCAAGG + Intergenic
982403851 4:154998874-154998896 CCCAAGGAAGTTCTTGCTCATGG + Intergenic
982834641 4:160109014-160109036 CACAAGGATAGAGCTGCCCAAGG - Intergenic
985345657 4:189001897-189001919 CAGAGGGAAGGACCTGCCCAGGG + Intergenic
985382041 4:189404917-189404939 GCCCAAGAAGGAGCTGCCCAAGG + Intergenic
985547383 5:516505-516527 ACCAAGTCAGGGCCTGCCCAGGG + Intronic
986379283 5:7166713-7166735 CCCAAGGAGGCAGATGCCCATGG - Intergenic
987612386 5:20223162-20223184 CACAGGGATGGAGCTGCCCAAGG + Intronic
988400520 5:30754582-30754604 CCACAGGCAGGAGCTGCCCAAGG + Intergenic
988456077 5:31388400-31388422 CACAGGGAAGGAGCTGCCTAAGG - Intergenic
988490086 5:31698787-31698809 CACGAGGAAGTACCTGCACAAGG + Intronic
988759444 5:34297464-34297486 CACAAGGATAGAACTGCCCAAGG + Intergenic
989261491 5:39424260-39424282 CCTAAGGAAGTATCTACCCAAGG - Intronic
991358783 5:65798276-65798298 GACATAGAAGGACCTGCCCAGGG + Intronic
991956013 5:71996762-71996784 CCCAAGGAAGGCCTCACCCATGG + Intergenic
992311008 5:75498953-75498975 CACAGGGACGGAGCTGCCCAAGG + Intronic
994023124 5:95050998-95051020 ACCAAGGAAGGATCTGTCCCAGG - Intronic
994689476 5:102999328-102999350 CACAGGGATGGAGCTGCCCAAGG - Intronic
996255934 5:121403007-121403029 CACAGGGACGGAGCTGCCCAAGG + Intergenic
996997194 5:129711724-129711746 CCCAAGGAATGAGCTCTCCATGG - Intronic
997590319 5:135068217-135068239 GCCAAAGAAGGGCCTGCCAAGGG - Intronic
1000376812 5:160590281-160590303 GCCAAGCAAAGACCTGGCCAGGG + Intronic
1001543625 5:172556498-172556520 CCCAAGAGAGGACATGGCCATGG - Intergenic
1002135312 5:177104053-177104075 CCCCAGGAAGGAGTGGCCCATGG - Intergenic
1002875332 6:1204734-1204756 ACCTGGGAAGGCCCTGCCCAGGG + Intergenic
1003869455 6:10390470-10390492 CCCAAGGACGGACGCGCCCTCGG - Intergenic
1004430281 6:15536833-15536855 ACCCATGAAGGAGCTGCCCAAGG + Intronic
1005308589 6:24537378-24537400 CCCAGAGAAGGGCCTGTCCATGG + Intergenic
1005783463 6:29217952-29217974 CACAAGGATGGAGTTGCCCAAGG + Intergenic
1006454797 6:34125608-34125630 CACAGGGAAGGGCCTGCCCAAGG + Intronic
1007383516 6:41505120-41505142 CGCCAGTAAGGCCCTGCCCAGGG - Intergenic
1007470877 6:42089474-42089496 ACAATGGAGGGACCTGCCCAAGG + Intergenic
1008940534 6:57041074-57041096 GCCCAGGATGGACCTGCCCTGGG + Intergenic
1009594538 6:65717241-65717263 CACAAGGATGAAGCTGCCCAAGG + Intergenic
1009620091 6:66064071-66064093 CACAAGGGGGGAGCTGCCCAAGG + Intergenic
1010171019 6:72975555-72975577 CACATGAAAGTACCTGCCCAAGG - Intronic
1010655678 6:78508077-78508099 CACAGGGGAGGAGCTGCCCAAGG + Intergenic
1011249166 6:85352772-85352794 CCTCCTGAAGGACCTGCCCAAGG + Intergenic
1012064833 6:94537233-94537255 CACAAGGGTGGAGCTGCCCAAGG - Intergenic
1012448625 6:99331762-99331784 GGAAAGGAAGGACCTGCACAAGG - Intronic
1012485945 6:99722714-99722736 GCCCATGAAGGAGCTGCCCAAGG + Intergenic
1013088310 6:106875550-106875572 CCCAGGGGTGGAGCTGCCCAAGG - Intergenic
1015045131 6:128767870-128767892 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1016128383 6:140434431-140434453 CACATGGATGGAGCTGCCCAAGG + Intergenic
1017817738 6:158027662-158027684 CCCAAGGAAGCCCCTCCCCTGGG + Intronic
1017969149 6:159296051-159296073 GCCAAGGAAGTACCTGCCTACGG + Intergenic
1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG + Intronic
1020140107 7:5607228-5607250 CCGATGTAGGGACCTGCCCAGGG - Intergenic
1020909850 7:14115440-14115462 CCCATGGCAGGACAGGCCCATGG - Intergenic
1022108444 7:27213386-27213408 CCCAAGAAGGGGCCTGCCCGCGG - Intergenic
1023281077 7:38570728-38570750 CCTCCTGAAGGACCTGCCCAAGG - Intronic
1023625400 7:42110513-42110535 TCCAAGAAAGGACAAGCCCACGG + Intronic
1023837798 7:44078692-44078714 CCCCAGGAATGTCCTGCCCTGGG - Intronic
1024607842 7:51037395-51037417 CTTAGGGAAGGAACTGCCCATGG - Intronic
1025263772 7:57439589-57439611 CCCATGGAAAGAACAGCCCATGG - Intergenic
1025635460 7:63316521-63316543 CCCATGGAAAGAACAGCCCATGG + Intergenic
1025647235 7:63431649-63431671 CCCATGGAAAGAACAGCCCATGG - Intergenic
1026384434 7:69832074-69832096 CTCAGAGAAGGACCTCCCCAGGG + Intronic
1026830041 7:73605181-73605203 CCCAAGAGAGTACCTGGCCAGGG - Intronic
1027029136 7:74875285-74875307 CCCAAGGCAGACCCTGCCCTGGG + Intergenic
1028522560 7:91747835-91747857 ACCAAGGACTGACCTGCCCAAGG + Intronic
1028653461 7:93175421-93175443 CACAAGGCTGGAGCTGCCCAAGG + Intergenic
1030527585 7:110672813-110672835 CACAGGGACGGAGCTGCCCAAGG - Intronic
1030573733 7:111260030-111260052 CCTACTGAAGGACCTGCCTAAGG + Intronic
1030938269 7:115613926-115613948 CCAAAGGAAGCACTTGTCCAAGG - Intergenic
1032480718 7:132244643-132244665 CCCAAGGAAGGACAGAACCAGGG + Intronic
1032492002 7:132330733-132330755 CACAAGGATGGACATGTCCAAGG + Intronic
1032990126 7:137384917-137384939 CACAAGGGAGGTCCTACCCATGG - Intronic
1034269237 7:149795661-149795683 CCCAAGGTATCACCCGCCCAAGG + Intergenic
1034276554 7:149826377-149826399 CCCAGGGAGGGAGCTGCCCTGGG - Intergenic
1034983306 7:155491752-155491774 GCCAGGGAAGGAGCTGCCCACGG - Intronic
1035016722 7:155773237-155773259 CCCATGCCAGGACCTGCCCAGGG + Intronic
1035293401 7:157854198-157854220 CCCAATGTAGGCCCTGTCCAGGG - Intronic
1036212269 8:6852158-6852180 CCCAAGGAAGAAACTTCCAAAGG - Intergenic
1040540138 8:48346496-48346518 CACAAGGGTGGAGCTGCCCAAGG + Intergenic
1040741390 8:50580055-50580077 CACAGGGGTGGACCTGCCCAAGG + Intronic
1043591084 8:81834757-81834779 CCCAGGGGTGGAGCTGCCCAAGG - Intronic
1044727548 8:95205578-95205600 GCCAAGGCATGACCTGCTCATGG + Intergenic
1045002756 8:97892874-97892896 CCCAGTGAAGGTCCTGCCCACGG + Intronic
1046056197 8:109082048-109082070 CACAGGGATGGATCTGCCCAAGG - Intergenic
1046481196 8:114821136-114821158 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1046831516 8:118751593-118751615 CACAAGGATGGAGCTGCCCAAGG + Intergenic
1048213496 8:132476443-132476465 CACAAGGGTGGAGCTGCCCAAGG + Intronic
1048292614 8:133192094-133192116 CCCAGGGCAGGACCTGCTCCTGG + Intronic
1048497220 8:134945363-134945385 CCCAAGGAAGAAGCAACCCACGG - Intergenic
1048516219 8:135113959-135113981 CACAAGGGTGGAGCTGCCCAAGG + Intergenic
1049014177 8:139908018-139908040 CCCAGGGCAGCACCAGCCCAGGG + Intronic
1049176063 8:141193410-141193432 CCCCAGGTGGGACCCGCCCACGG - Intronic
1049376863 8:142293516-142293538 CTCCAGGAGAGACCTGCCCAGGG + Intronic
1049418734 8:142507449-142507471 CCCAAGGAGGCACCTGCCCCTGG - Intronic
1052686584 9:31764896-31764918 CTCAGGGACAGACCTGCCCAAGG - Intergenic
1053681628 9:40489529-40489551 GCCAGGGAGAGACCTGCCCAAGG + Intergenic
1053931621 9:43117859-43117881 GCCAGGGAGAGACCTGCCCAAGG + Intergenic
1054282085 9:63135405-63135427 GCCAGGGAGAGACCTGCCCAAGG - Intergenic
1054294720 9:63325046-63325068 GCCAGGGAGAGACCTGCCCAAGG + Intergenic
1054392739 9:64629533-64629555 GCCAGGGAGAGACCTGCCCAAGG + Intergenic
1054427389 9:65134742-65134764 GCCAGGGAGAGACCTGCCCAAGG + Intergenic
1054502988 9:65886798-65886820 GCCAGGGAGAGACCTGCCCAAGG - Intronic
1056322729 9:85452052-85452074 GCCACAGAAAGACCTGCCCAAGG - Intergenic
1058634592 9:107024104-107024126 CCCAAGGAAGAACCTGGACATGG + Intergenic
1058651853 9:107182156-107182178 CCCAAGAACTGGCCTGCCCAGGG + Intergenic
1058670776 9:107359004-107359026 CCCAAGGAAGGGGCTCCCCAGGG + Intergenic
1059140011 9:111844256-111844278 CACATGGAAGGCCATGCCCAGGG - Intergenic
1059339684 9:113590631-113590653 CCCGAGGAAGGAATTGCACATGG + Intronic
1059885138 9:118737114-118737136 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1060414114 9:123418779-123418801 GGCAAGCAAGGACTTGCCCAGGG + Intronic
1061245350 9:129398727-129398749 CCCCAGGAGGGAGCTGGCCAGGG + Intergenic
1061383651 9:130275836-130275858 TCCAAGGAGGGACGTGCCCAGGG - Intergenic
1061453389 9:130681122-130681144 CTCAAGGACGGACCGGCCCCGGG + Intronic
1062115804 9:134807659-134807681 TCCAGGGAAGTTCCTGCCCAGGG - Intronic
1062207008 9:135342870-135342892 CCCAAGGAAGGCCCTGCCAAAGG + Intergenic
1062563047 9:137150357-137150379 CCCAGAAAAAGACCTGCCCAGGG + Intronic
1062563132 9:137150651-137150673 CCCAAGGAAAGCTCCGCCCAGGG + Intronic
1062563279 9:137151156-137151178 CCCAGGGAAAGCCCCGCCCAGGG + Intronic
1062563366 9:137151471-137151493 CCCAGGGAAAGCCCCGCCCAGGG + Intronic
1062673356 9:137724409-137724431 CACAAGGAAAGACCTAGCCATGG - Intronic
1203688857 Un_GL000214v1:23368-23390 CCCAAAGAAGGACCTGGCTCGGG - Intergenic
1203458288 Un_GL000220v1:11001-11023 ACCAGGGAATGTCCTGCCCAGGG + Intergenic
1203370326 Un_KI270442v1:297750-297772 CACAAGGTAGAACCTTCCCAAGG - Intergenic
1203647418 Un_KI270751v1:80685-80707 CCCAAAGAAGGACCTGGCTCGGG + Intergenic
1189079796 X:37958974-37958996 CACAGGGATGGAACTGCCCAAGG - Intronic
1190772585 X:53527457-53527479 CACAAGGGAAGAGCTGCCCAAGG + Intergenic
1192131843 X:68559123-68559145 GCCCATGAAGGAGCTGCCCAAGG - Intergenic
1192841990 X:74866159-74866181 CACAGGGATGGAGCTGCCCAAGG + Intronic
1193467265 X:81865359-81865381 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1194092800 X:89599825-89599847 CACAGGGGAGGAGCTGCCCAAGG - Intergenic
1194281784 X:91962464-91962486 CACAGGGATGGAGCTGCCCAAGG - Intronic
1194397271 X:93401824-93401846 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1194412262 X:93571707-93571729 ACCTAAGAAGAACCTGCCCAAGG + Intergenic
1194860289 X:98990962-98990984 CACAAGGATGGAACTGCCCAAGG - Intergenic
1195195171 X:102490272-102490294 GCCCATGAAGGAGCTGCCCAAGG - Intergenic
1196996336 X:121388102-121388124 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1197345191 X:125321087-125321109 CCCAAGGAATGACTTCCCAAGGG + Intergenic
1199823151 X:151471066-151471088 CACAAGGGTGGAGCTGCCCAAGG - Intergenic
1200000020 X:153055660-153055682 GCCAAGGAAGGGCAGGCCCAAGG + Intergenic
1200096693 X:153667910-153667932 CCCAAGGTTGGACTTCCCCAAGG + Intergenic
1200445438 Y:3255929-3255951 CACAGGGGAGGAGCTGCCCAAGG - Intergenic
1200599379 Y:5187118-5187140 CACAGGGATGGAGCTGCCCAAGG - Intronic
1201065117 Y:10089504-10089526 CCCAAGGAAGACCTGGCCCATGG + Intergenic
1201979410 Y:19891191-19891213 CCAAACGAAGGCCCTTCCCAGGG + Intergenic