ID: 1184929321

View in Genome Browser
Species Human (GRCh38)
Location 22:47669277-47669299
Sequence GAGAATAATTCAGCCAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184929311_1184929321 28 Left 1184929311 22:47669226-47669248 CCACAATGTGAAAAATAAACAAC No data
Right 1184929321 22:47669277-47669299 GAGAATAATTCAGCCAGTGGTGG No data
1184929319_1184929321 -2 Left 1184929319 22:47669256-47669278 CCAGGTGGTTGGAGGGAGGCTGA No data
Right 1184929321 22:47669277-47669299 GAGAATAATTCAGCCAGTGGTGG No data
1184929317_1184929321 4 Left 1184929317 22:47669250-47669272 CCTGTTCCAGGTGGTTGGAGGGA No data
Right 1184929321 22:47669277-47669299 GAGAATAATTCAGCCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184929321 Original CRISPR GAGAATAATTCAGCCAGTGG TGG Intergenic
No off target data available for this crispr