ID: 1184932379

View in Genome Browser
Species Human (GRCh38)
Location 22:47690828-47690850
Sequence CTTACACAGAAGTGGTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184932379_1184932382 3 Left 1184932379 22:47690828-47690850 CCTGGGAACCACTTCTGTGTAAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1184932382 22:47690854-47690876 CTCAAACCTTCCCCTCAAAGTGG No data
1184932379_1184932386 14 Left 1184932379 22:47690828-47690850 CCTGGGAACCACTTCTGTGTAAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1184932386 22:47690865-47690887 CCCTCAAAGTGGCTTTCCAGAGG No data
1184932379_1184932388 15 Left 1184932379 22:47690828-47690850 CCTGGGAACCACTTCTGTGTAAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1184932388 22:47690866-47690888 CCTCAAAGTGGCTTTCCAGAGGG No data
1184932379_1184932389 20 Left 1184932379 22:47690828-47690850 CCTGGGAACCACTTCTGTGTAAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1184932389 22:47690871-47690893 AAGTGGCTTTCCAGAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184932379 Original CRISPR CTTACACAGAAGTGGTTCCC AGG (reversed) Intergenic
900710048 1:4107900-4107922 GGTACACAGAAGTGGTGCCAAGG - Intergenic
901555933 1:10031587-10031609 CTTACACAGAATTCCTTTCCTGG + Intergenic
906766003 1:48434810-48434832 CTTGCCTAAAAGTGGTTCCCAGG + Intronic
915515813 1:156412043-156412065 CTTAACTAGAAGTGGTCCCCAGG - Intronic
916562734 1:165947518-165947540 CTTACACAGACACGTTTCCCAGG - Intergenic
920833724 1:209488393-209488415 CTTGCACTGAGGGGGTTCCCGGG + Intergenic
922454911 1:225766918-225766940 CTGACACAGAAGTGTAGCCCTGG - Intergenic
922593954 1:226799334-226799356 CTCAGACAGAAGAGGCTCCCAGG - Intergenic
923129618 1:231064202-231064224 CTTACACAATTATGGTTCCCTGG + Intergenic
923526671 1:234778262-234778284 CTAAGACAGAAGGGGTTTCCTGG - Intergenic
1064423960 10:15213795-15213817 CTGACATAGGAGTGGTCCCCGGG + Exonic
1067004755 10:42650141-42650163 TCTACACAGCAGTGGTACCCTGG - Intergenic
1070916459 10:80158247-80158269 CTTTCACCGCAGTGGTTGCCAGG - Intronic
1075246705 10:120828927-120828949 CTGACACAGGAGGGTTTCCCTGG + Intergenic
1078351958 11:10602144-10602166 CTGACTCAGCAGTGGTGCCCAGG - Intronic
1080064085 11:27989407-27989429 CTTGCTCAGAAGTGGTTTACAGG - Intergenic
1083858893 11:65408948-65408970 CTTCCAGAGAAGTTGTGCCCAGG + Intronic
1087997491 11:104828224-104828246 CTAACACAGAAGTTATTCTCTGG - Intergenic
1088859653 11:113787922-113787944 CTGGCACAAAAGTGGTACCCAGG - Intergenic
1089016049 11:115166420-115166442 GTTAACCAGGAGTGGTTCCCTGG + Intergenic
1091155126 11:133365102-133365124 ATTGCACAGCAGTGGTTCCCAGG - Intronic
1092691893 12:11121094-11121116 CTGACACAGAAGAAGTTCCAAGG + Intronic
1093735898 12:22619915-22619937 CTTACTAAAAAGTTGTTCCCTGG - Intergenic
1099050896 12:77780691-77780713 CTTACAAAAAGATGGTTCCCAGG + Intergenic
1105570209 13:21595573-21595595 CTACCACAGAGGTGGTGCCCTGG - Intronic
1112409987 13:99154672-99154694 CTTAAAGAAAAGTGGTTCCTTGG + Intergenic
1117457503 14:55912638-55912660 CCTACACAGAAATGCTTCACAGG + Intergenic
1118608221 14:67518758-67518780 GTTAGAGAGAATTGGTTCCCAGG + Intronic
1119875211 14:78053695-78053717 CTTGCACAGAACTGGAGCCCAGG - Intergenic
1120085276 14:80264891-80264913 CTTACACAGCTGTGGTTATCAGG + Intronic
1121294164 14:92803968-92803990 CATAACCAAAAGTGGTTCCCTGG - Intronic
1125724342 15:41860723-41860745 CTTCCACAGAAGGGGCTCCATGG + Exonic
1126176817 15:45743452-45743474 CTTCCTCAGAAGTTGATCCCCGG - Intergenic
1131370320 15:91875568-91875590 ATCACACACAAGTGCTTCCCAGG - Intronic
1132851164 16:2025655-2025677 CTTGCACATACCTGGTTCCCAGG - Intronic
1136002033 16:27302120-27302142 CTTACACTGTAGTGGTTGGCTGG + Intergenic
1137705488 16:50532966-50532988 CTTACACAGCAGTAGGTGCCCGG - Intergenic
1137850828 16:51740698-51740720 CTTACTCAGAAGTGCTTTCTGGG - Intergenic
1138685957 16:58726087-58726109 CTAACACAGAACATGTTCCCAGG + Intronic
1139839550 16:69867583-69867605 CTGACACAGATGAGGTCCCCAGG - Intronic
1142974613 17:3636165-3636187 CCTTCACAGATGTGGTGCCCAGG + Exonic
1149110384 17:53020701-53020723 ATTGCACAGAAGTTGTTCCTTGG + Intergenic
1157170626 18:45401714-45401736 CTTATACAGAAGTTGTTTCAGGG + Intronic
1164243941 19:23414613-23414635 CTTACACAGCAGTGGATGGCAGG - Intergenic
1165059500 19:33198193-33198215 CTTTCAGAAAAGTGCTTCCCTGG + Intronic
927695188 2:25235108-25235130 CTGTCACTGCAGTGGTTCCCTGG + Intronic
928309619 2:30198502-30198524 ATTACAATGAGGTGGTTCCCAGG - Intergenic
940033450 2:149288928-149288950 CTGACATATAAGAGGTTCCCCGG + Intergenic
943451145 2:188043923-188043945 CTAAGACAGAAGTGGGTACCAGG + Intergenic
947645070 2:231732793-231732815 CCTACACAGAGCTGGTCCCCTGG + Exonic
948544918 2:238720664-238720686 ATTACACAGAAGAGGTGCACTGG + Intergenic
1175344212 20:58259909-58259931 ATTCCATACAAGTGGTTCCCAGG - Intergenic
1176875191 21:14120097-14120119 TCTACACAGCAGTGGTACCCTGG - Intronic
1177344475 21:19852433-19852455 CTTACACAGAATTAGATCCAAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1180946540 22:19696879-19696901 CCTGCACAGAGGTGGTTGCCAGG + Intergenic
1180946547 22:19696910-19696932 CCTGCACAGAGGTGGTTGCCAGG + Intergenic
1180946554 22:19696941-19696963 CCTGCACAGAGGTGGTTGCCAGG + Intergenic
1180946561 22:19696972-19696994 CCTGCACAGAGGTGGTTGCCAGG + Intergenic
1181539098 22:23563833-23563855 CATACACAGAAATGCATCCCAGG + Intergenic
1183508197 22:38220823-38220845 CTTCAACAGAAGCGGTGCCCAGG + Exonic
1184932379 22:47690828-47690850 CTTACACAGAAGTGGTTCCCAGG - Intergenic
949946007 3:9190790-9190812 CCTACACAGGAGTTGTTTCCAGG - Intronic
953902652 3:46851972-46851994 CCACCACAGAAGTGGTTCCCTGG - Intergenic
954108622 3:48422253-48422275 CTCACCCACAAGTGGGTCCCTGG + Intronic
954155650 3:48683614-48683636 CAAACACAGAACTGCTTCCCAGG - Intronic
955990804 3:64625384-64625406 TGTACACAGAAGAGGTTCCAAGG + Intronic
956288625 3:67637660-67637682 CTGATAAAGAACTGGTTCCCTGG - Intronic
957531938 3:81451656-81451678 CTTTCACAGAATGGGCTCCCAGG + Intergenic
957959331 3:87228443-87228465 CTTACAAAGAAGTGATTCTTTGG - Intronic
961075535 3:123978375-123978397 ATTCCACAGAAGTGCTGCCCAGG + Intronic
961308151 3:125974133-125974155 ATTCCACAGAAGTGCTGCCCGGG - Intronic
965571597 3:170178877-170178899 TTGACACAGAAGATGTTCCCGGG + Exonic
965922783 3:173939432-173939454 TTTACACACAACAGGTTCCCTGG + Intronic
976512013 4:85921943-85921965 CTTCCACAAAACTGGGTCCCTGG + Intronic
979839732 4:125423324-125423346 TTTACACAGCAGGGGTGCCCTGG - Intronic
982140572 4:152313691-152313713 GTAACACAGAGGTGGTCCCCTGG + Intergenic
983878879 4:172910787-172910809 CTTCCACAGGTGTGGATCCCAGG + Intronic
984746391 4:183223754-183223776 CTTACCCAGAAGTCTTACCCAGG + Intronic
985062085 4:186090019-186090041 CTTACACTGAGCTGGTTCCTAGG - Intergenic
986719616 5:10551672-10551694 CTAGCACTGAGGTGGTTCCCAGG + Intergenic
990300245 5:54442422-54442444 CTTGCTCAGAAGTGGTTCTTGGG - Intergenic
992847895 5:80772503-80772525 CTAAGACAGAATTGGGTCCCAGG + Intronic
995947089 5:117661044-117661066 CTTACAAAGAAGTGGATTCCAGG - Intergenic
997414670 5:133716537-133716559 TTTACACAGAAGTAGTTCCGTGG - Intergenic
998407070 5:141879996-141880018 CTTCCACAGAAGAGCTGCCCCGG + Intergenic
998497213 5:142601344-142601366 CTGAGACAGAAGAGGTTCCCAGG + Intronic
1001416441 5:171547708-171547730 CCTGCACAGCAGTGGTTGCCTGG - Intergenic
1002722549 5:181271983-181272005 CTTACACTGATGTGGTCCCTCGG + Intergenic
1003616644 6:7660568-7660590 CTGACACAGAACTGGGTCACTGG - Intergenic
1008360532 6:50612434-50612456 ATTGCAAAGAGGTGGTTCCCAGG - Intergenic
1010714127 6:79208517-79208539 CTAACACTGAAGTGGTTCTAAGG + Intronic
1011436059 6:87338325-87338347 GTTACTCTGAAGTGTTTCCCAGG - Intronic
1012765981 6:103367360-103367382 GTTTCAAAGAGGTGGTTCCCAGG + Intergenic
1021578813 7:22130422-22130444 CTTACAAGCAAGAGGTTCCCAGG - Intronic
1022196356 7:28071023-28071045 CTTACCTAGAACTGGTTACCGGG + Intronic
1027405417 7:77855130-77855152 AATACACATAAGTGGTACCCAGG - Intronic
1031079695 7:117246528-117246550 TTTAGAAAGAAGTTGTTCCCAGG + Intergenic
1034830369 7:154303401-154303423 CTTACACCGCAGTGGCTCCCAGG + Intronic
1039465530 8:37782786-37782808 CTTAGAGAAAAGTGGTTCCTTGG + Intergenic
1039510293 8:38086620-38086642 TCTACACAGCAGTGGTACCCTGG + Intergenic
1041441723 8:57904377-57904399 AGTAAACAGAAGAGGTTCCCTGG + Intergenic
1044848904 8:96408762-96408784 CTTCCACAGTAGTGGTCCCCAGG + Intergenic
1046243407 8:111527775-111527797 TTGTCACAGAAGTGTTTCCCAGG - Intergenic
1047048714 8:121084731-121084753 CTTACACAAAATTGGTTCTCCGG + Intergenic
1048005840 8:130418890-130418912 CTTCCACAGCAGTGATTCCAGGG - Intronic
1049627740 8:143633601-143633623 CTGCCACAGAAGTGGTCCTCAGG + Intergenic
1051345278 9:16145650-16145672 CTTACACAGCATTTGCTCCCTGG + Intergenic
1051830212 9:21267544-21267566 CTTATGCAGAAGTGTGTCCCTGG - Intergenic
1059299671 9:113302285-113302307 CTGAAACAGCAGTGGATCCCTGG - Intronic
1060518724 9:124281956-124281978 CAGACACAGAAGTGGAGCCCGGG + Intronic
1060870936 9:127039664-127039686 CTTACACTGAAGAGGCACCCAGG - Intronic
1061275232 9:129566354-129566376 CATACACAGAAATGCATCCCAGG + Intergenic
1188083173 X:25870532-25870554 CTTACAAATAAGAGGTTTCCAGG - Intergenic
1192504601 X:71673526-71673548 GTTACACAGCAGAGGTTCCAGGG - Intergenic
1192583580 X:72303783-72303805 CTTCCAAAGAAGTGATTTCCTGG + Intronic
1196349592 X:114710756-114710778 CTTAGACAGTAGTACTTCCCAGG + Intronic