ID: 1184938654

View in Genome Browser
Species Human (GRCh38)
Location 22:47743840-47743862
Sequence CAAAATGCACAGAGGCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184938650_1184938654 -6 Left 1184938650 22:47743823-47743845 CCAGTCAGATGGTCCTCCAAAAT No data
Right 1184938654 22:47743840-47743862 CAAAATGCACAGAGGCAATTTGG No data
1184938649_1184938654 3 Left 1184938649 22:47743814-47743836 CCTTTCTAACCAGTCAGATGGTC No data
Right 1184938654 22:47743840-47743862 CAAAATGCACAGAGGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184938654 Original CRISPR CAAAATGCACAGAGGCAATT TGG Intergenic
No off target data available for this crispr