ID: 1184940013

View in Genome Browser
Species Human (GRCh38)
Location 22:47757219-47757241
Sequence TGTCAGGTAAAGAATGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184940013_1184940020 14 Left 1184940013 22:47757219-47757241 CCACCAACATTCTTTACCTGACA No data
Right 1184940020 22:47757256-47757278 AACACCAGCCACCTGGATTTCGG No data
1184940013_1184940025 26 Left 1184940013 22:47757219-47757241 CCACCAACATTCTTTACCTGACA No data
Right 1184940025 22:47757268-47757290 CTGGATTTCGGAATTGCTATGGG No data
1184940013_1184940024 25 Left 1184940013 22:47757219-47757241 CCACCAACATTCTTTACCTGACA No data
Right 1184940024 22:47757267-47757289 CCTGGATTTCGGAATTGCTATGG No data
1184940013_1184940017 -9 Left 1184940013 22:47757219-47757241 CCACCAACATTCTTTACCTGACA No data
Right 1184940017 22:47757233-47757255 TACCTGACAATAGGGAACTGTGG No data
1184940013_1184940019 7 Left 1184940013 22:47757219-47757241 CCACCAACATTCTTTACCTGACA No data
Right 1184940019 22:47757249-47757271 ACTGTGGAACACCAGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184940013 Original CRISPR TGTCAGGTAAAGAATGTTGG TGG (reversed) Intergenic
No off target data available for this crispr