ID: 1184942728

View in Genome Browser
Species Human (GRCh38)
Location 22:47780954-47780976
Sequence AATGGATGGTTGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184942722_1184942728 7 Left 1184942722 22:47780924-47780946 CCTCAATTTAAATGATTACAAGT No data
Right 1184942728 22:47780954-47780976 AATGGATGGTTGGAGGATGGAGG No data
1184942721_1184942728 22 Left 1184942721 22:47780909-47780931 CCACGTGGTTTATGGCCTCAATT No data
Right 1184942728 22:47780954-47780976 AATGGATGGTTGGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184942728 Original CRISPR AATGGATGGTTGGAGGATGG AGG Intergenic
No off target data available for this crispr