ID: 1184942762

View in Genome Browser
Species Human (GRCh38)
Location 22:47781166-47781188
Sequence GCTCTGAGTGGCGCGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184942756_1184942762 22 Left 1184942756 22:47781121-47781143 CCAGATTCAGTATGCGGAGGATC No data
Right 1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG No data
1184942751_1184942762 29 Left 1184942751 22:47781114-47781136 CCCCGTGCCAGATTCAGTATGCG No data
Right 1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG No data
1184942754_1184942762 27 Left 1184942754 22:47781116-47781138 CCGTGCCAGATTCAGTATGCGGA No data
Right 1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG No data
1184942752_1184942762 28 Left 1184942752 22:47781115-47781137 CCCGTGCCAGATTCAGTATGCGG No data
Right 1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184942762 Original CRISPR GCTCTGAGTGGCGCGGGCTT TGG Intergenic
No off target data available for this crispr