ID: 1184943996

View in Genome Browser
Species Human (GRCh38)
Location 22:47788141-47788163
Sequence CTGAACTTCACCACTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184943991_1184943996 -2 Left 1184943991 22:47788120-47788142 CCTACCTGGCATATTTAGGAGCT No data
Right 1184943996 22:47788141-47788163 CTGAACTTCACCACTGGGGCAGG No data
1184943992_1184943996 -6 Left 1184943992 22:47788124-47788146 CCTGGCATATTTAGGAGCTGAAC No data
Right 1184943996 22:47788141-47788163 CTGAACTTCACCACTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184943996 Original CRISPR CTGAACTTCACCACTGGGGC AGG Intergenic
No off target data available for this crispr