ID: 1184944794

View in Genome Browser
Species Human (GRCh38)
Location 22:47795560-47795582
Sequence TGTCCCTGAGGCCGGGCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184944788_1184944794 0 Left 1184944788 22:47795537-47795559 CCTGAGGCCAAGGCCAAGTCTGA No data
Right 1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG No data
1184944783_1184944794 19 Left 1184944783 22:47795518-47795540 CCCGTGAGGACACGGGATCCCTG No data
Right 1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG No data
1184944784_1184944794 18 Left 1184944784 22:47795519-47795541 CCGTGAGGACACGGGATCCCTGA No data
Right 1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG No data
1184944789_1184944794 -7 Left 1184944789 22:47795544-47795566 CCAAGGCCAAGTCTGATGTCCCT No data
Right 1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG No data
1184944780_1184944794 29 Left 1184944780 22:47795508-47795530 CCATGTGAAGCCCGTGAGGACAC No data
Right 1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG No data
1184944787_1184944794 1 Left 1184944787 22:47795536-47795558 CCCTGAGGCCAAGGCCAAGTCTG No data
Right 1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184944794 Original CRISPR TGTCCCTGAGGCCGGGCCGA TGG Intergenic