ID: 1184945189

View in Genome Browser
Species Human (GRCh38)
Location 22:47797601-47797623
Sequence AATTATTTAAAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184945183_1184945189 14 Left 1184945183 22:47797564-47797586 CCCAGCATGCGGGGATCTGCAAG No data
Right 1184945189 22:47797601-47797623 AATTATTTAAAGATGGAGCAGGG No data
1184945179_1184945189 25 Left 1184945179 22:47797553-47797575 CCGGGAGGATGCCCAGCATGCGG No data
Right 1184945189 22:47797601-47797623 AATTATTTAAAGATGGAGCAGGG No data
1184945178_1184945189 26 Left 1184945178 22:47797552-47797574 CCCGGGAGGATGCCCAGCATGCG No data
Right 1184945189 22:47797601-47797623 AATTATTTAAAGATGGAGCAGGG No data
1184945184_1184945189 13 Left 1184945184 22:47797565-47797587 CCAGCATGCGGGGATCTGCAAGG No data
Right 1184945189 22:47797601-47797623 AATTATTTAAAGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184945189 Original CRISPR AATTATTTAAAGATGGAGCA GGG Intergenic
No off target data available for this crispr