ID: 1184946142

View in Genome Browser
Species Human (GRCh38)
Location 22:47805482-47805504
Sequence TTAGGTGACTGGTTGTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184946136_1184946142 -5 Left 1184946136 22:47805464-47805486 CCAAACCATATCCCTAGCTTAGG No data
Right 1184946142 22:47805482-47805504 TTAGGTGACTGGTTGTTGCATGG No data
1184946138_1184946142 -10 Left 1184946138 22:47805469-47805491 CCATATCCCTAGCTTAGGTGACT No data
Right 1184946142 22:47805482-47805504 TTAGGTGACTGGTTGTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184946142 Original CRISPR TTAGGTGACTGGTTGTTGCA TGG Intergenic
No off target data available for this crispr