ID: 1184947123

View in Genome Browser
Species Human (GRCh38)
Location 22:47811382-47811404
Sequence CACTCAGCACACACAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184947123_1184947125 0 Left 1184947123 22:47811382-47811404 CCTGCTTCTGTGTGTGCTGAGTG No data
Right 1184947125 22:47811405-47811427 TTGACTGGCATGAATCCTTACGG No data
1184947123_1184947126 4 Left 1184947123 22:47811382-47811404 CCTGCTTCTGTGTGTGCTGAGTG No data
Right 1184947126 22:47811409-47811431 CTGGCATGAATCCTTACGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184947123 Original CRISPR CACTCAGCACACACAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr