ID: 1184951330

View in Genome Browser
Species Human (GRCh38)
Location 22:47844521-47844543
Sequence CCTCCTGTGCAGGAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184951318_1184951330 30 Left 1184951318 22:47844468-47844490 CCCTGGGAGATAGACACATTCAT No data
Right 1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG No data
1184951321_1184951330 3 Left 1184951321 22:47844495-47844517 CCTCTCAAACTCATAACTGGCCC No data
Right 1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG No data
1184951319_1184951330 29 Left 1184951319 22:47844469-47844491 CCTGGGAGATAGACACATTCATC No data
Right 1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184951330 Original CRISPR CCTCCTGTGCAGGAGGGACA GGG Intergenic
No off target data available for this crispr