ID: 1184954565

View in Genome Browser
Species Human (GRCh38)
Location 22:47877131-47877153
Sequence CGGTGGTGGCCCGGACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184954565_1184954571 1 Left 1184954565 22:47877131-47877153 CCATCTGGTCCGGGCCACCACCG No data
Right 1184954571 22:47877155-47877177 CACTCCCTTGGCCTGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184954565 Original CRISPR CGGTGGTGGCCCGGACCAGA TGG (reversed) Intergenic
No off target data available for this crispr