ID: 1184956707

View in Genome Browser
Species Human (GRCh38)
Location 22:47892058-47892080
Sequence AATGGCTCCTGCTTCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184956707_1184956714 14 Left 1184956707 22:47892058-47892080 CCTGCTGAGAAGCAGGAGCCATT No data
Right 1184956714 22:47892095-47892117 CCACAAGTTGGGCAAAGCGGAGG No data
1184956707_1184956712 11 Left 1184956707 22:47892058-47892080 CCTGCTGAGAAGCAGGAGCCATT No data
Right 1184956712 22:47892092-47892114 GAACCACAAGTTGGGCAAAGCGG No data
1184956707_1184956710 2 Left 1184956707 22:47892058-47892080 CCTGCTGAGAAGCAGGAGCCATT No data
Right 1184956710 22:47892083-47892105 TAGGTTCTAGAACCACAAGTTGG No data
1184956707_1184956711 3 Left 1184956707 22:47892058-47892080 CCTGCTGAGAAGCAGGAGCCATT No data
Right 1184956711 22:47892084-47892106 AGGTTCTAGAACCACAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184956707 Original CRISPR AATGGCTCCTGCTTCTCAGC AGG (reversed) Intergenic