ID: 1184956714

View in Genome Browser
Species Human (GRCh38)
Location 22:47892095-47892117
Sequence CCACAAGTTGGGCAAAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184956706_1184956714 15 Left 1184956706 22:47892057-47892079 CCCTGCTGAGAAGCAGGAGCCAT No data
Right 1184956714 22:47892095-47892117 CCACAAGTTGGGCAAAGCGGAGG No data
1184956702_1184956714 25 Left 1184956702 22:47892047-47892069 CCTGGTGTCCCCCTGCTGAGAAG No data
Right 1184956714 22:47892095-47892117 CCACAAGTTGGGCAAAGCGGAGG No data
1184956704_1184956714 17 Left 1184956704 22:47892055-47892077 CCCCCTGCTGAGAAGCAGGAGCC No data
Right 1184956714 22:47892095-47892117 CCACAAGTTGGGCAAAGCGGAGG No data
1184956709_1184956714 -4 Left 1184956709 22:47892076-47892098 CCATTGCTAGGTTCTAGAACCAC No data
Right 1184956714 22:47892095-47892117 CCACAAGTTGGGCAAAGCGGAGG No data
1184956707_1184956714 14 Left 1184956707 22:47892058-47892080 CCTGCTGAGAAGCAGGAGCCATT No data
Right 1184956714 22:47892095-47892117 CCACAAGTTGGGCAAAGCGGAGG No data
1184956705_1184956714 16 Left 1184956705 22:47892056-47892078 CCCCTGCTGAGAAGCAGGAGCCA No data
Right 1184956714 22:47892095-47892117 CCACAAGTTGGGCAAAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184956714 Original CRISPR CCACAAGTTGGGCAAAGCGG AGG Intergenic
No off target data available for this crispr