ID: 1184956902

View in Genome Browser
Species Human (GRCh38)
Location 22:47894041-47894063
Sequence GGCTGATCCCGTGGGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184956902_1184956907 4 Left 1184956902 22:47894041-47894063 CCAGAGCTCCCACGGGATCAGCC No data
Right 1184956907 22:47894068-47894090 CTTCCGATAGAACTGCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184956902 Original CRISPR GGCTGATCCCGTGGGAGCTC TGG (reversed) Intergenic