ID: 1184956907

View in Genome Browser
Species Human (GRCh38)
Location 22:47894068-47894090
Sequence CTTCCGATAGAACTGCATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184956904_1184956907 -4 Left 1184956904 22:47894049-47894071 CCCACGGGATCAGCCAAGGCTTC No data
Right 1184956907 22:47894068-47894090 CTTCCGATAGAACTGCATCCCGG No data
1184956899_1184956907 15 Left 1184956899 22:47894030-47894052 CCACTGCAGCTCCAGAGCTCCCA No data
Right 1184956907 22:47894068-47894090 CTTCCGATAGAACTGCATCCCGG No data
1184956905_1184956907 -5 Left 1184956905 22:47894050-47894072 CCACGGGATCAGCCAAGGCTTCC No data
Right 1184956907 22:47894068-47894090 CTTCCGATAGAACTGCATCCCGG No data
1184956902_1184956907 4 Left 1184956902 22:47894041-47894063 CCAGAGCTCCCACGGGATCAGCC No data
Right 1184956907 22:47894068-47894090 CTTCCGATAGAACTGCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184956907 Original CRISPR CTTCCGATAGAACTGCATCC CGG Intergenic