ID: 1184959466

View in Genome Browser
Species Human (GRCh38)
Location 22:47918563-47918585
Sequence CTGTGGGTGTGGAGGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 630}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184959466_1184959483 20 Left 1184959466 22:47918563-47918585 CCAGACTCCCTCCACACCCACAG 0: 1
1: 0
2: 1
3: 58
4: 630
Right 1184959483 22:47918606-47918628 CCCCACAGATGGTGACTGGCGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1184959466_1184959478 9 Left 1184959466 22:47918563-47918585 CCAGACTCCCTCCACACCCACAG 0: 1
1: 0
2: 1
3: 58
4: 630
Right 1184959478 22:47918595-47918617 AGGAAGCCTGGCCCCACAGATGG 0: 1
1: 0
2: 3
3: 36
4: 288
1184959466_1184959480 16 Left 1184959466 22:47918563-47918585 CCAGACTCCCTCCACACCCACAG 0: 1
1: 0
2: 1
3: 58
4: 630
Right 1184959480 22:47918602-47918624 CTGGCCCCACAGATGGTGACTGG 0: 1
1: 0
2: 4
3: 19
4: 207
1184959466_1184959481 19 Left 1184959466 22:47918563-47918585 CCAGACTCCCTCCACACCCACAG 0: 1
1: 0
2: 1
3: 58
4: 630
Right 1184959481 22:47918605-47918627 GCCCCACAGATGGTGACTGGCGG 0: 1
1: 0
2: 2
3: 18
4: 201
1184959466_1184959473 -3 Left 1184959466 22:47918563-47918585 CCAGACTCCCTCCACACCCACAG 0: 1
1: 0
2: 1
3: 58
4: 630
Right 1184959473 22:47918583-47918605 CAGTGCCCCCTGAGGAAGCCTGG 0: 1
1: 0
2: 3
3: 32
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184959466 Original CRISPR CTGTGGGTGTGGAGGGAGTC TGG (reversed) Intergenic
900154983 1:1200329-1200351 CTGTGGGGATGGAGGGTGTGTGG - Intergenic
900316131 1:2057312-2057334 CTGGGGGTCTGCAGGGCGTCTGG + Intronic
900578533 1:3396065-3396087 CTCAGGGTGTGGAGTGAATCTGG - Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901559690 1:10060079-10060101 GTGTGTGTGTGGAGGGGGTTGGG + Intronic
901679740 1:10906146-10906168 CTGTGGGGGTGGGGAGAGCCTGG + Intergenic
901868814 1:12125597-12125619 CTGCTGGTGTGGCCGGAGTCAGG - Intronic
902408838 1:16201304-16201326 CTTTGGGTGTGAAGTGAGGCTGG - Intronic
902551159 1:17220343-17220365 CAGAGGTTGTGGAGGGGGTCTGG + Intronic
902721691 1:18308434-18308456 GTGTGTGTGTGGAGGGGCTCTGG - Intronic
902917356 1:19646641-19646663 CAGAGGGTGTGGAGGGTGGCTGG - Intronic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903253256 1:22072475-22072497 TTGTGGGTGGGGAGGGATTCAGG + Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903778238 1:25806584-25806606 CTGTAGGCGGGGAGGGAGTAGGG + Intronic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904388831 1:30165783-30165805 CTGGGGGTGTAGAGTCAGTCTGG + Intergenic
904594520 1:31635127-31635149 CTGTGGGTGTGCAGGCAGCCTGG - Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905630152 1:39514096-39514118 CTGAGGAGGTGGAGGGAGACAGG + Intronic
905667608 1:39772094-39772116 CTGAGGAGGTGGAGGGAGACAGG - Intronic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906276645 1:44521566-44521588 CTGTGGGTGTGGGTGGGGGCAGG + Intronic
906334885 1:44920517-44920539 GTGTGGGGGTGGTGGGAGTGGGG - Intronic
906698256 1:47839349-47839371 GTGTGTGTGTGGTGGGAGTGAGG - Intronic
907030468 1:51166161-51166183 CTGAGGGTGTGGAGGGGGTGGGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
910118878 1:83762035-83762057 CAGGAGGTGTGGAGGGGGTCAGG - Intergenic
912502013 1:110128997-110129019 CTGGGGGTGGGGAGTGAGTGGGG + Intergenic
912808854 1:112778313-112778335 CAGAGGGTGTGGAAGGAGTAAGG - Intergenic
914902246 1:151716951-151716973 CTGGGGGCGGGAAGGGAGTCAGG - Intronic
915217053 1:154347354-154347376 GTGGGGGTGTGGAATGAGTCAGG + Intronic
915436561 1:155911185-155911207 CTGGGGGTGGGGAGGGGGTTCGG - Intronic
915545105 1:156592495-156592517 CTGTGGGGGAGGAGGGCGTGAGG + Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
916276699 1:163001688-163001710 CTGAGGCTGGAGAGGGAGTCAGG - Intergenic
916337371 1:163688379-163688401 CTTTGGGTGAGGAAGGATTCTGG - Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920096903 1:203492276-203492298 CTGTGGGGGTGGAGGGCCTCTGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920215082 1:204357292-204357314 ATCTGGATGTGGAGGGAGTCTGG + Intronic
920225897 1:204438906-204438928 TTGTGGGTGGGGAGTGCGTCTGG - Intronic
920284410 1:204869132-204869154 ATGTGGGGCTGGAGGGAGCCAGG + Intronic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
922516090 1:226209347-226209369 CTGGGGGTGCGGGGAGAGTCTGG + Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923372257 1:233326871-233326893 CTGTGGGTTTCCAGGGAGACTGG + Intergenic
923933447 1:238730630-238730652 CTGGGGGTTTGGGGGAAGTCTGG + Intergenic
924775566 1:247112734-247112756 CTGTAGGTGGGGAGGCAGGCAGG + Intergenic
1062888490 10:1037825-1037847 CTGTGTGTGTGGAGGGGCTGGGG - Intergenic
1063282437 10:4645131-4645153 CTGTGGGTGTGGCAGGAATTGGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064220943 10:13439949-13439971 CTGTGGGTGTTTAGGGCGACTGG - Intronic
1064353221 10:14595913-14595935 CTGTGGTTGTGGAGGGCCACGGG - Intronic
1065410929 10:25427198-25427220 CAGTGGGTGTGAAGGGTGTTGGG + Intronic
1066087948 10:31989302-31989324 CTGTGGGTGGGGAGTGGGTGGGG + Intergenic
1066126263 10:32346385-32346407 CTGTGGGGGTGCGGCGAGTCGGG - Intronic
1067030411 10:42875744-42875766 CTCTGGGTGTGGCAGGAGGCTGG + Intergenic
1067053466 10:43038327-43038349 CTGGGAGGGTGGAGGGAGGCGGG + Intergenic
1067668867 10:48301804-48301826 CAGTGGGTGTGGATGGAGAGAGG + Intergenic
1067801939 10:49365386-49365408 CTGTGGGTGTGGAACTAGTGTGG - Exonic
1068637449 10:59362924-59362946 CTGGGGGTGGGGTGGGAGTGTGG - Intronic
1068849378 10:61719472-61719494 GTGTGTGTGTGGAGGGTGTGGGG - Intronic
1068875732 10:61994607-61994629 CTGGGGGTGGGGAAGGAGTCGGG - Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069959765 10:72072821-72072843 ATGAGGGTGTGGAGGGACACAGG + Intronic
1070354373 10:75625493-75625515 GGGTGGGGTTGGAGGGAGTCAGG + Intronic
1070393447 10:75990833-75990855 CTGTGGGTGTGGAGGACTTCTGG + Intronic
1070567194 10:77612913-77612935 CAGTGGGGGTGGGGGGAGTAGGG - Intronic
1072636989 10:97184880-97184902 GGCTGGGTGTGGAGGGAGGCGGG + Intronic
1073009088 10:100346520-100346542 CTGTGTGTGCGGCCGGAGTCCGG + Intergenic
1073061204 10:100734942-100734964 CTGTGAGTGTGGCAGGAGTTTGG + Intergenic
1073099260 10:100998398-100998420 CTGAGGGTCTGGGGTGAGTCAGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073457793 10:103648037-103648059 ATGTGGGTGGGAAGGAAGTCGGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1075794173 10:125107049-125107071 CTTGGGGGGTGGAGGGAGGCTGG + Intronic
1075957444 10:126536180-126536202 GTGTGTGTGTGGAGGGGGTTGGG - Intronic
1076097015 10:127739983-127740005 GTGTGGGTGTGGTGTGAGTGTGG - Exonic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076485901 10:130816786-130816808 CAGTGGGTTTGGAAGGAGTCAGG - Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077030156 11:461869-461891 CTGTGGCTCTGGAGGCAGTGAGG + Intronic
1077037862 11:503955-503977 CTTTGGCTGTGTAGGGAGCCAGG - Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077292430 11:1804137-1804159 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292448 11:1804187-1804209 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292454 11:1804203-1804225 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292472 11:1804253-1804275 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292478 11:1804269-1804291 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292484 11:1804285-1804307 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077376921 11:2209507-2209529 CAGGGGGTGAGGAGGCAGTCTGG - Intergenic
1077391706 11:2303359-2303381 ATGTGGGTGGGGAGGGGGTGGGG + Intronic
1078266700 11:9760272-9760294 CTGTGGGCGGGCAGGGAGCCAGG + Intergenic
1078525470 11:12097578-12097600 ATGAGGGTGAGGAGGTAGTCAGG + Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1081602413 11:44504416-44504438 GTGTGTGTGTGGAGAGAGTATGG - Intergenic
1081771152 11:45651262-45651284 GTGTGGGAGTAGGGGGAGTCAGG - Intronic
1082909183 11:58350930-58350952 CTGTGGGTGAGTAGGAAGCCTGG + Intergenic
1083048984 11:59760181-59760203 CTGTGAGTGTGGGGGAAGTCGGG + Intronic
1083149302 11:60781862-60781884 ATGTGGGTGTGGCGAGAGCCTGG - Intergenic
1083243162 11:61404577-61404599 CTGGGTGTCTGGAGGGAGTTAGG + Exonic
1083275079 11:61592353-61592375 GTGTGTGTGTGTAGGGAGTGGGG + Intergenic
1083479392 11:62933929-62933951 CTCTGGATGTGGCTGGAGTCAGG + Intergenic
1083641814 11:64149750-64149772 CTGTGGCTGAGGGGGCAGTCAGG - Intronic
1083676968 11:64331716-64331738 ATGTGTGTGTGTAGGGAGTTGGG + Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083844676 11:65324195-65324217 CTGGGGGAGTGGTGGGTGTCTGG - Intergenic
1084955689 11:72690126-72690148 CTGTGGGTTTGGAAGAAGTCAGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085655420 11:78310151-78310173 ATGTGGGGGTGGAGGGAGTGAGG + Intronic
1085875578 11:80403310-80403332 CTATGGCAGTGGTGGGAGTCAGG + Intergenic
1085907403 11:80780626-80780648 CTTTGGCAGTGGAGGGATTCTGG + Intergenic
1086072881 11:82818823-82818845 CTCTTGGTGTGCAGGCAGTCGGG + Intergenic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1089013460 11:115148310-115148332 GTGTGGGTGTGGAGTGTGTGTGG + Intergenic
1089346574 11:117795403-117795425 CTGCGGGGGCGGAGGGAGGCAGG + Intronic
1089613289 11:119681458-119681480 CTGAAGGTGTGGAGGCAGGCAGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089907026 11:122050541-122050563 CTGTGAGAGAGGAGTGAGTCTGG - Intergenic
1089943381 11:122442205-122442227 CTGTGGGTGTGGAAAGAATGGGG - Intergenic
1090352358 11:126115459-126115481 CTGAGGGTGGACAGGGAGTCAGG + Intergenic
1091226182 11:133957493-133957515 GTCTGGGTGCGGAGGGAGACGGG - Intergenic
1091321677 11:134656590-134656612 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321691 11:134656646-134656668 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321705 11:134656702-134656724 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321713 11:134656730-134656752 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321721 11:134656758-134656780 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321737 11:134656814-134656836 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321745 11:134656842-134656864 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321761 11:134656898-134656920 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321785 11:134657010-134657032 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1091321793 11:134657038-134657060 CTGTGGGTGTGGGAGGTGCCCGG + Intergenic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091479362 12:810867-810889 CTGGGGGTGGGGTGGGGGTCAGG - Intronic
1091973649 12:4809074-4809096 CTGCGGGGGTGGAGGGGGTGTGG + Intronic
1092199357 12:6570512-6570534 CTGGGGGAGGGGAGGGAGTGAGG - Exonic
1092255114 12:6922637-6922659 GTGTGGGGGTGGTTGGAGTCTGG + Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1093414720 12:18907074-18907096 CTGTGGGTGGGGAGAGAGAGGGG - Intergenic
1095904381 12:47362497-47362519 CTGTGGGTCTGATGTGAGTCAGG + Intergenic
1096359140 12:50968391-50968413 GTGTGTGTGTGGGGGGAGACAGG + Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096579186 12:52573522-52573544 CTCTGGGTATGGAGGGGGCCGGG - Exonic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1097245329 12:57604868-57604890 CGGTGGGTGTGGGGGGCGCCGGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1100259001 12:92914125-92914147 CTGAGGGTGTGGTGGGGGTAGGG - Intronic
1101092642 12:101303554-101303576 CTGTGGGGGTGGTGGGTGCCTGG + Intronic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101811718 12:108113258-108113280 TGGTGGGTGTGGAGGTAGCCTGG + Intergenic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1102198670 12:111042443-111042465 CTTTGGGGGTGGAGGGTGTAGGG - Intronic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102912562 12:116728760-116728782 CTGTGGGCCTTGAGGGAGTTGGG - Intronic
1103074166 12:117968954-117968976 ATGTCGGTGTGGAGCGAGGCAGG - Intronic
1103219441 12:119231505-119231527 CCTGGGGTGTGGAGGGAGTCAGG + Intergenic
1103240004 12:119405141-119405163 CTGGGGGTGTGCACGGAGACAGG - Intronic
1103397945 12:120622334-120622356 ATGTCGGGGTGGAGGGTGTCTGG + Intergenic
1103705080 12:122867134-122867156 CGGCTGGTGTGGAGGGAGCCGGG + Exonic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104463735 12:128974100-128974122 CTGTGCGTGTGGAGGGGGAGAGG + Intronic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1105251883 13:18706718-18706740 CTGTGGATGCTGAGGGACTCTGG - Intergenic
1105423535 13:20273536-20273558 CTGTGGGTGTGGAGGTCCTGTGG + Intergenic
1105880109 13:24598031-24598053 CTGTGTGTGTGTTGGGAGTTGGG - Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106510258 13:30406990-30407012 CCTTGGGTGTGGAAGGTGTCCGG - Intergenic
1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG + Intergenic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1107574654 13:41705280-41705302 ATGTGTGTGTGCAGGGGGTCGGG + Intronic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1111735814 13:92138001-92138023 CTGTGTGTGTGTTGGGAGTAGGG + Intronic
1111860114 13:93693491-93693513 GTGTGTGTGTGTAGGGAGACAGG + Intronic
1112436958 13:99397476-99397498 CTGTGGGTGTGGCTGGTGTTAGG - Intergenic
1112551803 13:100428348-100428370 CTGAGGGTGTGGGGGGGGTGGGG - Intronic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113416058 13:110129602-110129624 GGGTGGGTGTGCAGGGAGTGGGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114191272 14:20441041-20441063 AGGCGGGTGTGCAGGGAGTCAGG + Intergenic
1114255053 14:20994498-20994520 CTGTGAGTGTGTAGGAAGTTAGG - Intronic
1114260867 14:21035187-21035209 CTGTGGGTGTGACAGGAGTAAGG - Intronic
1114472332 14:22972474-22972496 CTGTGGGTGTGGAGCTTGTTGGG - Exonic
1114499888 14:23160863-23160885 TAGTGGGAGTGGAGGGAGTTAGG - Intronic
1114519353 14:23323162-23323184 TTTTGGGTGTGGAGGGAGTGTGG + Intronic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1116096412 14:40375710-40375732 CGGTGGGTGTTGAGGGATTGTGG + Intergenic
1117182206 14:53202462-53202484 CTGTGGCTGTGGGGTGGGTCTGG - Intergenic
1117373893 14:55103387-55103409 ATCTGGGTGTGGAGGCTGTCGGG + Intergenic
1117607163 14:57441428-57441450 CTGTGGGTGGGGAGGTAATCAGG + Intergenic
1118866103 14:69704845-69704867 CTGTGTGTGTCCAGGGAGTGGGG + Intronic
1118883515 14:69848605-69848627 CTAGGGGTGTGGAGGGGGTTTGG + Intergenic
1119384042 14:74246067-74246089 CTCTGGGGGAGGATGGAGTCTGG + Intronic
1119399204 14:74350229-74350251 CTGTGGGTTGGGAGTGAGTGTGG + Intronic
1119855287 14:77895762-77895784 CAGTGGGTGGGGAGGGGGTCAGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121104055 14:91269468-91269490 CTGAGGGTGGGGTGGGAATCTGG - Intergenic
1122138438 14:99647775-99647797 CTGTCAGTGTGGAGGCACTCAGG + Intronic
1122406619 14:101504720-101504742 CCGCGGGGGAGGAGGGAGTCGGG + Intergenic
1122510689 14:102264825-102264847 CTGTGGCTCCGGAGGGAGCCTGG - Intronic
1122695743 14:103551229-103551251 CTGTGGGGGTGGAGGCGGCCTGG + Intergenic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1123047998 14:105527742-105527764 CTGGGGCTGTGGAGGGGGTGAGG + Intronic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1124168445 15:27350595-27350617 CAGGGAGTCTGGAGGGAGTCTGG + Intronic
1124224926 15:27885387-27885409 CTTTGGGTGTGAAGGGGGTTTGG - Intronic
1125196957 15:37058141-37058163 AGGTGGGTGTGGGGGGAGTAGGG - Intronic
1125673195 15:41487966-41487988 GTGTGGGTGTGGTGTGAGTGTGG - Intergenic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128894064 15:71356817-71356839 CTGTGAGTGTGAAGAAAGTCGGG - Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130298971 15:82665985-82666007 CTGTGAGTGAGGATGGTGTCGGG + Intronic
1130540174 15:84816778-84816800 CTGGGGGTGTTGGGGGAGACAGG + Exonic
1130553194 15:84905081-84905103 GTGTGGGCATGGAGAGAGTCGGG + Intronic
1130862543 15:87903918-87903940 CTGAGGTTGTGGAGAGGGTCTGG - Intronic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1131187961 15:90291974-90291996 CATGGGGTGTGGAGGGAGGCGGG - Intronic
1131534152 15:93220495-93220517 GTGTGGGTGTGGTGGGGGACAGG - Intergenic
1132279698 15:100602487-100602509 GGGTGGGGGTGGAGGGAGTAGGG - Intronic
1132306816 15:100821019-100821041 GTGTGGGTGGGGAGGACGTCAGG - Intergenic
1132496647 16:266520-266542 CTTTGGGTGTGGCGGCAGTGAGG + Intronic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133390434 16:5405776-5405798 CTTTGGGTGTGGAGTGTGACTGG + Intergenic
1134122919 16:11597339-11597361 CTGGGGGTGTGGGGAGAGGCTGG + Intronic
1134232137 16:12437623-12437645 CTATGGGTGGGGAAGGAGCCAGG - Intronic
1135223813 16:20637991-20638013 CAGTGTGTGTGGAGGTTGTCTGG + Intronic
1136505338 16:30699088-30699110 CGTTGGGTGGGGTGGGAGTCTGG + Intronic
1136561090 16:31039700-31039722 CTGTGGGAGAGGAGGGGGTCAGG - Intronic
1136632164 16:31495333-31495355 CTGTGGGTGTGGCAGGAAACTGG + Intronic
1137334516 16:47534112-47534134 CTGTGGGGTTGGCGGGAGCCAGG - Intronic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1137719605 16:50620323-50620345 GTGTGAGTGTGGTGGGAGTGTGG + Intronic
1138351989 16:56350876-56350898 GTGTGGGCGTTGGGGGAGTCTGG - Intronic
1139908185 16:70380842-70380864 CTGGGGGTAGGGACGGAGTCGGG + Exonic
1140196384 16:72859029-72859051 CAGAGGGTGTGGAGGGAGCCTGG - Intronic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141493929 16:84393735-84393757 CTATGGGTGTGGGGGGAGTGGGG + Intronic
1141834591 16:86530381-86530403 CTGAGGGTGGGGTGGGCGTCAGG + Exonic
1142130420 16:88429430-88429452 TAGTGGGTGGGGAGGGAGTGGGG - Exonic
1142144417 16:88486989-88487011 CTGTGAGGGTGGAGGAAATCAGG - Intronic
1142285055 16:89168300-89168322 CTCGGGGTGTGGAGGAAGCCAGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142631087 17:1227296-1227318 ATGTGGGTCTGGGGGGAGACAGG + Intronic
1142863077 17:2775358-2775380 CAGTGGGTGTGTGGGGACTCTGG + Intergenic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143152939 17:4818414-4818436 CTGTGGGTGTGGTTTGAGCCCGG + Intronic
1143225515 17:5299114-5299136 GTGTGTGTGTGGAGGGGGTGTGG + Intronic
1143461617 17:7108034-7108056 CTGTGGCAGTGCAGGGAGCCTGG - Intronic
1143554620 17:7652345-7652367 TTGGGGGGGTGGAGGGGGTCTGG + Intronic
1143584071 17:7842750-7842772 CTGTGTGTGTTCAGGGAGGCGGG + Intronic
1143880519 17:10026325-10026347 ATCTGGGTGTGGGGGGAGTGGGG - Intronic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1144867616 17:18347010-18347032 CTGTGGCTGTGGATGGTGCCGGG + Intronic
1145251923 17:21301463-21301485 GTGTGGGTGAGCAGGGAGGCCGG + Intronic
1145761325 17:27426769-27426791 CTGTGGCTGGGGAGGCAGCCTGG - Intergenic
1145912283 17:28549679-28549701 CAGTGGGTGTGGAAGGGGTAAGG + Intronic
1146679111 17:34794386-34794408 TTGCGGGTGTGGAGGAAATCGGG - Intergenic
1147042247 17:37727888-37727910 GAGTGGGTGTGGAGGGATTCGGG + Intronic
1147146087 17:38485292-38485314 CTGTGGGTGGAGTGGGAGTTTGG + Intronic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147600115 17:41740098-41740120 CTGTGGGAGAGGATGGAGACCGG + Intergenic
1148159715 17:45443010-45443032 ATGTGTGTGTGGATGGAGTGAGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150391001 17:64789882-64789904 ATGTGTGTGTGGATGGAGTGAGG + Intergenic
1150590101 17:66554649-66554671 CTATGGATGTGAAGGGAGTTTGG + Intronic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151175207 17:72282433-72282455 CTGGGGATGTGGAGGGTGTGCGG - Intergenic
1151391693 17:73791499-73791521 GTGTGTGTGTGGAGGGGGTGTGG - Intergenic
1151830473 17:76546322-76546344 GTGGGGGTGTGGTGGGAGCCAGG + Intronic
1151903948 17:77035698-77035720 CAGTGGGAGTGGGGGAAGTCAGG - Intergenic
1152185672 17:78855104-78855126 CCTTGGATGTGGGGGGAGTCAGG + Exonic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152313860 17:79568555-79568577 CTTTAGTTGTGGTGGGAGTCAGG - Intergenic
1152596933 17:81242375-81242397 CTGTGGGTGGGATGGGAGGCTGG - Intergenic
1152611573 17:81317450-81317472 CTGGGGGTGTGGATAGAGTAGGG + Intronic
1152616153 17:81338799-81338821 CTGTGGGGGTGTGGGGAGTGAGG + Intergenic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1152797172 17:82314193-82314215 GTGTGGGTGTGGGGTGAGTGAGG + Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153440382 18:5111225-5111247 CTGTGGGGGTTGGGGGAGCCTGG - Intergenic
1154174568 18:12076824-12076846 CTCTGGGCCTGGAGGGAGCCAGG + Intergenic
1154333480 18:13448592-13448614 GTGTAAGTGTGGTGGGAGTCGGG + Intronic
1154370296 18:13754990-13755012 CAGTGGGTGTTGAGGAAGTCAGG + Intronic
1155077039 18:22367795-22367817 CTGTGTGTGTGGCGGGAGCTGGG + Intergenic
1155177297 18:23312188-23312210 CTGTGGGTATGGTGGGGGACAGG - Intronic
1155239094 18:23848187-23848209 GTGGGAGTGAGGAGGGAGTCAGG + Intronic
1156551470 18:38023627-38023649 CTGAGGCTGTGGTGGGAGTGGGG - Intergenic
1157449977 18:47778777-47778799 CTGGGAGGGTGGAGGGAGTTGGG + Intergenic
1158245782 18:55430695-55430717 TTGTGGATGTTGAGGGAGACAGG + Intronic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159341666 18:67141644-67141666 CTGTGCCTCTGGAGGCAGTCTGG + Intergenic
1159877290 18:73826970-73826992 CTGAGGCTGTGGCAGGAGTCTGG + Intergenic
1160240426 18:77118884-77118906 CTGTGTGTGTGGTGTGTGTCTGG - Intronic
1160400359 18:78606346-78606368 TTGTGTGTGTGGAGGGTGTGCGG - Intergenic
1160425714 18:78777886-78777908 GTGTGGATGTGGAGGAAGACAGG - Intergenic
1160831348 19:1106125-1106147 CTGTGGCTGTGGAGGCAGCCGGG + Intronic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161767950 19:6217225-6217247 GCGGGGTTGTGGAGGGAGTCTGG - Intronic
1161871955 19:6877066-6877088 CTGTGGGTTTGAAGGGTGTCTGG + Intergenic
1162142271 19:8592041-8592063 CAGAGGGTGTGGACGGAGCCTGG - Exonic
1162495538 19:11021338-11021360 CTGCTGGTGTGGAGGGTCTCAGG - Intronic
1162588501 19:11576211-11576233 CTGTGGGTGGGGTGGGAGCTGGG - Intronic
1162780923 19:13006745-13006767 CTTTGGGGGTGGAGAGAATCTGG - Intronic
1163311829 19:16519512-16519534 ATGTGGGGATGGATGGAGTCAGG - Intronic
1163326296 19:16605551-16605573 CTGTGTGTGTGCAGTGAGTGGGG - Intronic
1163849169 19:19653857-19653879 GTGTGGATGTGGTGGTAGTCGGG + Exonic
1163884867 19:19956598-19956620 ATGTGGCTGTGGCGGGACTCAGG - Intergenic
1163908339 19:20167412-20167434 AAGTGGCTGTGGAGGGACTCAGG + Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164977291 19:32582512-32582534 CTGTGGGGGTGACGTGAGTCCGG + Intronic
1165070114 19:33250847-33250869 CTGTGTGTGTGGTGTGAGTGTGG - Intergenic
1165706898 19:37982769-37982791 ATGTGGCTGTGGAGGGAGAGAGG + Intronic
1165879291 19:39031563-39031585 CTGTGGGAGGGGTGGGAGTGGGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166332666 19:42088007-42088029 CTGGGGGGCTGGAGGGAGCCAGG - Intronic
1166960066 19:46491929-46491951 CTGTGGGTGGGGAGGGCCCCAGG - Exonic
1166975537 19:46603078-46603100 CTGTGGGTGTTGTGGGTGGCAGG - Intronic
1167120614 19:47514460-47514482 CTGGGGGGACGGAGGGAGTCCGG - Intronic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167423051 19:49415026-49415048 CTGTGGGTGTGGAGTGGATGGGG - Intronic
1167497895 19:49830137-49830159 CTGAGGGTGCGGCGGGAGGCAGG - Exonic
1168072101 19:53959102-53959124 GTGTGTGTGTGGGGGGGGTCAGG - Intergenic
1168162537 19:54521139-54521161 ACGTGGGTGAGGAGGGACTCGGG + Intergenic
1168393252 19:56027831-56027853 GTATGGCTGTGGAGGGAGTGTGG + Exonic
1168707655 19:58479121-58479143 ATGGGGCTGTGGAGGGAGCCTGG - Intronic
925439300 2:3870045-3870067 TTGTGGGTCTGGAGGGTGTTTGG + Intergenic
925617286 2:5755689-5755711 GTTGGGGTGTGGAGGGAGTGGGG + Intergenic
925851966 2:8090740-8090762 CAGCGGGTTTGGAGGGAGCCCGG - Intergenic
926152254 2:10431930-10431952 CACGGGGTGGGGAGGGAGTCAGG - Intergenic
926437423 2:12852342-12852364 CGATGGGTGTGGAGGGGGACGGG + Intergenic
928115917 2:28545213-28545235 GTATGGGTGTGGAGAGAGTGAGG - Intronic
928126366 2:28619397-28619419 ATGTGGGTGAGGAGGGAGTGTGG + Intronic
928478677 2:31657830-31657852 CTGTGGGTGTGAAGAGTGTGTGG + Intergenic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929292350 2:40207980-40208002 CTGTGGCTGTGAAGGAGGTCTGG - Intronic
929897719 2:45976285-45976307 CTTTGTGTGTGGAGGGACTCGGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931147514 2:59535247-59535269 CTGTGGGTGGGGTTGGAGGCTGG + Intergenic
931665464 2:64607160-64607182 CTGTGGGTGTGGAAGCTGTGAGG + Intergenic
931693834 2:64857844-64857866 CTGTGGGTGTGAAGACAGTGGGG + Intergenic
931757916 2:65390391-65390413 CTGTGGGACTGGAGTGAGCCTGG + Intronic
934524387 2:95042628-95042650 CTGTGGGGTCGGAGGAAGTCTGG + Intronic
935268802 2:101416167-101416189 CACTGGGGGTGGAGGGAGTGTGG + Intronic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
935527532 2:104189513-104189535 GTGTGGGTGTGGAGGTTGTTGGG - Intergenic
935571135 2:104661128-104661150 CTGGGAGGGTGGAGGGAATCAGG - Intergenic
935985412 2:108667732-108667754 CTGAGGGTGAGGTGGGAGTGGGG - Intronic
936137841 2:109911381-109911403 CTGAGGGTGAGGTGGGAGTGGGG - Intergenic
936206856 2:110460104-110460126 CTGAGGGTGAGGTGGGAGTGGGG + Intronic
936373353 2:111921047-111921069 CTGTGGGGGTAAAGGGAGTGGGG + Intronic
936374327 2:111927768-111927790 GTGTGTGTGTGCAGGGAGTAGGG - Intronic
937040315 2:118815788-118815810 CTGTGGGTGTGGGGCAGGTCTGG - Intergenic
937086883 2:119177839-119177861 CTGGGGGTGTGCAGAGAGCCTGG - Intergenic
937198292 2:120179896-120179918 CAGTGGAGGTGGAGGGAGTGTGG + Intergenic
937895335 2:126973478-126973500 GTGTGGGTGTGGAGCCAGTTTGG - Intergenic
938164767 2:129017112-129017134 CAGTGGGTGTGGCAGGAGCCAGG + Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
940682487 2:156804219-156804241 CTGTGGGTCAGGAGAGTGTCAGG + Intergenic
941186813 2:162328101-162328123 AAGGAGGTGTGGAGGGAGTCCGG + Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
944970130 2:204983390-204983412 TGGTGGCTGTGGGGGGAGTCGGG + Intronic
944982120 2:205133417-205133439 CAGTAGGTGTGGAGGGAGCCTGG - Intronic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946433391 2:219637212-219637234 GTGTGGGTGTGGTGTGAGTATGG + Intronic
947220670 2:227788819-227788841 TTGAGGGTGAGGAGGGAGTTGGG + Intergenic
947751946 2:232537493-232537515 CTGTTGGTCTGGAGAGAGTAAGG - Intergenic
948004922 2:234600196-234600218 CTGTGTGTGTGGTGGGCGTAGGG - Intergenic
948945051 2:241215151-241215173 CTTTGGCTGGGGAGGGGGTCTGG + Intronic
949064780 2:241983478-241983500 CTGTGGCTGTGGGAGGAGCCGGG + Intergenic
1168868493 20:1109065-1109087 GTGTGTGTGTGGTGGGGGTCGGG - Intergenic
1169661584 20:7984260-7984282 CTGTGGGTGGGGAAGGATTGAGG + Intronic
1170394906 20:15915674-15915696 GTGTGGGGGTGTAGGGAGGCAGG + Intronic
1170647374 20:18209422-18209444 GTGTGGGTGTGGAGAAGGTCTGG - Intergenic
1171343101 20:24445760-24445782 CTGTGTTTGTCGTGGGAGTCAGG + Intergenic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172324943 20:34027106-34027128 CGGGGGATGTGGAGGGAGTGGGG - Intronic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1172875935 20:38164428-38164450 TTGTGTGTGGGGAGGGAGTCAGG + Intronic
1172989835 20:39026609-39026631 CTTGAGGTGTGGTGGGAGTCCGG + Intronic
1173095858 20:40027570-40027592 GTGTGTGTGTGTAGGGAGACTGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173580892 20:44145814-44145836 CTAGGGTTGTGCAGGGAGTCGGG - Intronic
1173658211 20:44715487-44715509 ATTTGGGTGTGGAGGGGGTGGGG + Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174102821 20:48140095-48140117 CTGTGGCTGGGGAGGAGGTCTGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174289829 20:49500195-49500217 CTGTGGCCTTGGAGGCAGTCAGG - Intergenic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1175084252 20:56445578-56445600 CTCTGGGTGTCGAGGGGGGCCGG - Intronic
1175172429 20:57090039-57090061 CTGGGGGTGGGGAGGTTGTCAGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1176424239 21:6538173-6538195 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1178534086 21:33398288-33398310 CTGTGGGTATGGCAGGAGTGGGG + Intergenic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179188789 21:39106367-39106389 CTGTGTGTGTGGAGAGTGTTTGG - Intergenic
1179326875 21:40355197-40355219 CTATGGGTGTGGAGGCAGCCAGG + Intronic
1179644428 21:42766954-42766976 CTGGGGGTGGGGTGGGAGTGGGG - Intronic
1179659630 21:42865960-42865982 GTGTGGGTGTGGATGGTGCCTGG - Intronic
1179699732 21:43146488-43146510 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1179801451 21:43813301-43813323 GTCTGGGTGTCCAGGGAGTCTGG - Intergenic
1179884271 21:44306771-44306793 CTGTGTGTGTGCAGGGAGTGGGG + Intronic
1180044953 21:45301074-45301096 CTGCGGGTGTGGGGGGCTTCTGG - Intergenic
1180122257 21:45761688-45761710 CTGTGGGTGTGGTTGGTCTCTGG + Intronic
1180200711 21:46222499-46222521 CTGTGGGTGTGGGGTGGGTGAGG - Intronic
1180204300 21:46248098-46248120 ATGTGGGTGTGTAAGGAGTCAGG + Intronic
1180639978 22:17290666-17290688 CAGTGAGGGTGGAGGGTGTCGGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180948913 22:19712016-19712038 ATGTGTCTGTGGAGGGACTCGGG + Intergenic
1181308509 22:21930809-21930831 CTGTGGGTGAGGAAGGCCTCAGG - Intronic
1181436810 22:22915936-22915958 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181437651 22:22919862-22919884 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181438299 22:22922917-22922939 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182711789 22:32327833-32327855 CAGAGGGTGTGCAGGGAGGCCGG - Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183294539 22:37021900-37021922 ATGTGGGTGTGTAGGGTCTCTGG - Intronic
1183665768 22:39244926-39244948 CTGCGGGTGCGCAGGGAGGCAGG + Intergenic
1183739401 22:39661780-39661802 CTGTGGATGTGGATGGAGTGAGG + Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184406734 22:44304737-44304759 CTGTGGGAGTGGAGAGTGACGGG + Intronic
1184686904 22:46100360-46100382 CTGGGGCTGTGGAGGGCCTCTGG + Intronic
1184769668 22:46589853-46589875 CTGAGGGAGGGGAGGCAGTCAGG - Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185020842 22:48373973-48373995 CTGGGGCTCTGGTGGGAGTCAGG + Intergenic
1185193003 22:49450651-49450673 ATGTGTGTGTTTAGGGAGTCAGG - Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185243020 22:49756466-49756488 CTGTGGGGGACGTGGGAGTCAGG - Intergenic
1185259847 22:49855434-49855456 CTGTGTGTGTGGAGGGGGTTGGG - Intronic
950098925 3:10345643-10345665 CTGAGGAAGTGGAGGGAGTGAGG - Intronic
950116971 3:10457214-10457236 GTGTGGGTGTGTAGGGTGTATGG + Intronic
950556368 3:13698627-13698649 CTGGGGGCGGGGAGGGAGTGTGG - Intergenic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
952942753 3:38455894-38455916 CAGCGGGTCTGGAGGCAGTCAGG - Intronic
953431777 3:42845996-42846018 GGGTGGGGGTGGAGGTAGTCTGG + Intronic
953865780 3:46582029-46582051 CTGCGTGTGTGCAGGGAGACTGG + Exonic
954145263 3:48631307-48631329 CTGTGGGAGAGGACAGAGTCAGG + Intronic
954211198 3:49098453-49098475 CAGTGGTTGTGTAGAGAGTCTGG - Exonic
954671665 3:52294357-52294379 CTGAGGGTGTGGAGGGGCCCTGG + Intergenic
954701069 3:52451198-52451220 CTGGGGTTGGGGAGGGGGTCGGG - Exonic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG + Intronic
956534936 3:70265485-70265507 GTGTGTGTGTGCAGGGAGTATGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957355701 3:79082856-79082878 TTGATGGTGTGGAGGGAGGCAGG + Intronic
957593211 3:82226163-82226185 CTGTGGGTGGGGGGTGGGTCAGG + Intergenic
959388193 3:105739562-105739584 CTTTGTGTGTGGAGTGAGTGGGG + Intronic
959567740 3:107849630-107849652 GTGTGGATGTGGTAGGAGTCGGG - Intergenic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960117788 3:113913908-113913930 GTGTGGGTTTAGAGGGAGTGAGG + Intronic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960742062 3:120845353-120845375 CTCTGGGTGTGGCGGCAGTTAGG + Intergenic
961029928 3:123592924-123592946 CTATGGGTGTGGGAGGAGGCTGG - Intergenic
962409362 3:135127927-135127949 GTTTGGGTGAGGAGGGAGTGTGG - Intronic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
965210354 3:165779006-165779028 TTGTGGGTGGGGAGGGTGACTGG - Intronic
966875748 3:184320692-184320714 GGGTGGGTGTGGAGGCAGTGCGG - Exonic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967651076 3:191987994-191988016 AGGTGGGGGTGGAGGGAGTAGGG - Intergenic
967700402 3:192585689-192585711 TTGTGGGTGTTGAGGGGCTCGGG - Intronic
968500115 4:945976-945998 CTATGGGGATGGAAGGAGTCAGG - Intronic
968539144 4:1154232-1154254 CTGGGTGTGTGAAGGGAGTCTGG + Intergenic
969147167 4:5134015-5134037 CTGTTGATGGGGAGAGAGTCAGG - Intronic
969444739 4:7238270-7238292 CTGGGGAGGTAGAGGGAGTCTGG + Intronic
969531019 4:7730220-7730242 TAGTGGGTGTGAAGGGATTCTGG - Intronic
969554363 4:7896529-7896551 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969554381 4:7896587-7896609 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969554399 4:7896645-7896667 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969554444 4:7896790-7896812 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969593414 4:8134417-8134439 CTGTGGGTGTGGAGAGGGAGGGG - Intronic
969848585 4:9938907-9938929 CTGGGGGTGGGGATGGAGTGGGG + Intronic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
970257200 4:14180796-14180818 GTGAGGGTGTTGAGGGATTCTGG + Intergenic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971487285 4:27173129-27173151 CTGTGGATGTGGTGGAAGCCTGG + Intergenic
972359656 4:38315208-38315230 CTGTGCGTGAGGAGAGAGGCTGG + Intergenic
972852863 4:43072061-43072083 CTGGGGGTGGGTAGGGAGTTAGG + Intergenic
972931191 4:44072731-44072753 CTGTGGAGCTGGAGGGAGCCAGG - Intergenic
973224499 4:47767304-47767326 CTGTGCGTGTGGGTGGAGTGAGG - Intronic
973779407 4:54274072-54274094 CTGTGTATGTGGATGGAGTGTGG + Intronic
974124038 4:57673769-57673791 CTGAGGGGGTGGAGGCAGTGAGG + Intergenic
974149261 4:57984803-57984825 CAGTGGGTTTAGAGGGAGTAGGG + Intergenic
975408931 4:74025109-74025131 GTGTGTGTGTGGAGGGTGTGGGG + Intergenic
975699483 4:77049321-77049343 TTTGGGGTGTTGAGGGAGTCAGG - Intronic
976516329 4:85971750-85971772 CCGTGGGTGGGGTGGGAGTGGGG - Intronic
977564966 4:98571325-98571347 CTGGCGGGGAGGAGGGAGTCTGG + Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
978747792 4:112213314-112213336 CTGGGGGTGGGGCGGGAGCCAGG - Intergenic
979687527 4:123527245-123527267 CAGTGGGTGTGGTGGGTCTCAGG + Intergenic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
981566326 4:146105312-146105334 GGGTGGGTGTGGATGGAGACAGG - Intergenic
982295331 4:153822123-153822145 CAGTGGGTGTAGAGGAAGACAGG + Intergenic
982452237 4:155566805-155566827 CTGTGGGTGGGGAGTGTGGCTGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985593327 5:776372-776394 CTGAGGGAGTGGAGGGGATCAGG + Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986249336 5:6042510-6042532 CTGTGGGTGGGGAGAGGGACAGG + Intergenic
986709871 5:10480871-10480893 CTGTGGGTGGGCAGGGAGCTAGG - Intergenic
987716145 5:21574141-21574163 CTGTGGTGGTGGAGGGGGTGGGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
989245312 5:39248062-39248084 CTGGGTGGGTGGAGAGAGTCAGG + Intronic
990439746 5:55832605-55832627 CGGTTGCTGGGGAGGGAGTCGGG + Intergenic
991584184 5:68186088-68186110 CTGTGTGTGTGGGTGGGGTCCGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992657984 5:78929409-78929431 CTGTGGGTGAAGAGGGGGTCAGG - Intronic
993038230 5:82781986-82782008 GTGTGTGTGTGTAGGGAGTGTGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993851563 5:93016421-93016443 CAGTATGTGTGGAGGGAGTGAGG + Intergenic
994666815 5:102715117-102715139 TTGTGGATGTGGAGAGATTCAGG - Intergenic
995402219 5:111756323-111756345 CGGGGGGGGTGGGGGGAGTCAGG + Intronic
995550473 5:113276177-113276199 CAGGGTGTCTGGAGGGAGTCAGG - Intronic
996513201 5:124340786-124340808 ATGTGGGTTTGGAGGTAATCAGG - Intergenic
999195162 5:149776944-149776966 CTGAGGGTGGGGAAGGACTCGGG - Intronic
1000123433 5:158220189-158220211 CTGAGGGTGTTTGGGGAGTCTGG + Intergenic
1000369110 5:160517956-160517978 CTGTGTGTGTGGTGGGGGCCAGG + Intergenic
1001629647 5:173165230-173165252 CTGGGGGTGTGCAGTGATTCGGG + Intergenic
1001872098 5:175165486-175165508 CTGTGTGTGTTGAGGGGGTGGGG - Intergenic
1002131416 5:177084336-177084358 ATGTGGTTGTGGGGGGAGACAGG - Intergenic
1002192045 5:177483462-177483484 CTGTGGTGGTGGAGGGAGTGGGG + Exonic
1002841539 6:910974-910996 CTGAGTGTGTGGAAGAAGTCAGG + Intergenic
1003107600 6:3227900-3227922 CTGGGGCTGTGGTGGGGGTCTGG + Intronic
1003364616 6:5460563-5460585 CTTTGGGATGGGAGGGAGTCAGG + Intronic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004764530 6:18710720-18710742 CTGTGGGTGTACAGGGCATCTGG - Intergenic
1005064031 6:21800989-21801011 TTGTGTGTGTGGTGGGAGTGGGG + Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006134059 6:31885017-31885039 CTGTGGGTGGGAAGGGAGTGAGG + Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006444422 6:34070769-34070791 CTGGGGGTGTGGCGGGGGTGTGG - Intronic
1006712770 6:36089374-36089396 CTGTTGGTGGGGTGGGGGTCAGG + Intronic
1006779551 6:36623068-36623090 GTGTGTGTGTGGAGGGGGTGAGG + Intergenic
1007679381 6:43624022-43624044 CAGTGTGTCTGGAGAGAGTCTGG - Exonic
1007746739 6:44047784-44047806 GTGAGGTTGTGGAGGCAGTCAGG - Intergenic
1008520812 6:52361476-52361498 TTGTGGGTGAGGAGCAAGTCGGG + Intronic
1009856000 6:69264670-69264692 GTGGGGGTGTGGAGTGAGTTTGG - Intronic
1012837696 6:104291295-104291317 AAGTGGGTGTGGAGGCAGACAGG - Intergenic
1013354564 6:109335538-109335560 CTGGGCGTGTGGATGGAGTTTGG + Intergenic
1014461385 6:121699837-121699859 GTGTGTGTGTGGTGGGAATCAGG + Intergenic
1015367239 6:132409882-132409904 GTGTGTGTGTGGAGAGAGACAGG - Intergenic
1015535869 6:134267117-134267139 GTGCGGGTGTTCAGGGAGTCAGG - Intronic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1017113382 6:150953365-150953387 GTGTGGGGGTGGAGGCAGCCGGG - Intronic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1018906559 6:168079279-168079301 CTGGGTGTGTGGAGGGCGCCAGG + Intronic
1019057864 6:169236030-169236052 GTGTGGATGGGGAGGGAGTGTGG - Intronic
1019348324 7:541354-541376 CTGTGGGTGGGGTGGGGGTGGGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019594811 7:1853629-1853651 GTGTGGGTGTGCAGGGCGGCGGG - Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021639201 7:22721790-22721812 CTGTGGGTGAGACGGGGGTCGGG - Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1024198923 7:47087504-47087526 CTATGGGTTGGGAAGGAGTCGGG - Intergenic
1024224934 7:47319314-47319336 CAGTGGGAGTGGAGGTAGACAGG - Intronic
1024410907 7:49039740-49039762 CTCTGGGTTGGTAGGGAGTCAGG - Intergenic
1024843352 7:53613749-53613771 ATGGGGGTGTGGAGGGAGTGAGG + Intergenic
1026948926 7:74334379-74334401 CCCTGGGAGGGGAGGGAGTCGGG + Intronic
1027475641 7:78627999-78628021 CTGTGGGTGATGGAGGAGTCAGG - Intronic
1028228765 7:88280744-88280766 CTGTAGATATGGAGGCAGTCAGG + Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029599043 7:101553234-101553256 CTGGGGGCCTGCAGGGAGTCAGG - Intronic
1029702402 7:102256057-102256079 CTGGGAGACTGGAGGGAGTCGGG - Exonic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1029736261 7:102467566-102467588 CTGTGGGAGTGGGGTGAGTCAGG + Intronic
1030178374 7:106678429-106678451 CTGTTGGTGCGGTGGGGGTCGGG + Intergenic
1031842539 7:126761708-126761730 CAGTGGTTGTGGGGGCAGTCAGG - Intronic
1031968324 7:128044629-128044651 CTGTGTGTGTGGCGGGGGTGGGG - Intronic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1032792138 7:135250188-135250210 CTGTGAGTGTGGTGGCACTCTGG + Intronic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033840669 7:145369960-145369982 TTGTGGGTGGGGAAGGGGTCTGG + Intergenic
1034497458 7:151431253-151431275 GCGTGGGTGGGGAGGGAGTGGGG + Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034896316 7:154878589-154878611 CTGTGGGAGTGGGAGGAGTCAGG - Intronic
1034967973 7:155403264-155403286 TGGTGGGTGAGGAGGGAGCCGGG + Intergenic
1035035853 7:155893291-155893313 CCGTGAGTGTTGAGGGAGCCAGG - Intergenic
1035075512 7:156174921-156174943 GGGTGGGTGTGGAGAGAGTCAGG + Intergenic
1035679746 8:1479181-1479203 CTGTGAGTCTGGAGTCAGTCAGG + Intergenic
1035898492 8:3431845-3431867 CTGTGGGCGTGGTGGCAGGCTGG - Intronic
1036162986 8:6406511-6406533 CTGTAGGTGAGGCGGGAGGCTGG - Intergenic
1038359801 8:26865255-26865277 CTTCGGGTAGGGAGGGAGTCCGG - Exonic
1041146410 8:54880898-54880920 TTGTGGGTGTGGAGCCAGTGTGG - Intergenic
1041292362 8:56319778-56319800 CTCCGGGTGGGGAGGGAGGCTGG + Intronic
1041784790 8:61619920-61619942 CTGTGGGAGAGGACAGAGTCTGG - Intronic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1044097165 8:88080761-88080783 ATGTGGGCGTGGAGAGTGTCTGG + Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044511894 8:93091300-93091322 GGGTGGGTGTGGAGGGTGTGTGG - Intergenic
1045125013 8:99079355-99079377 CTGTGGCTGTGGTGGCAGTTTGG + Intronic
1045469155 8:102495992-102496014 GTGTGTGTGTGGAGGGTGTGGGG - Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1045692625 8:104775119-104775141 CAGTGAGTGGGGAGGGAGACAGG + Intronic
1047291576 8:123535754-123535776 TTGTGGGGGTTGAGGGAGTTAGG - Intronic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047641797 8:126828559-126828581 CTATGGGTGTGGTGGGAGTTGGG - Intergenic
1047722346 8:127652927-127652949 CTGTGGGCGAGGAAGGAGTCAGG - Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049353503 8:142176689-142176711 TTATGGGTGTGCAGGGAGTGGGG - Intergenic
1049454102 8:142678305-142678327 GTGTGTGTCTGGAGGGAGACCGG - Intronic
1049726730 8:144150011-144150033 CTGGGTGTGTGCAGGGAGACTGG - Intronic
1049798117 8:144505678-144505700 CCGTGGGCGCGGAGGGAGTGGGG - Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1053280334 9:36816454-36816476 CTGTGCCTCTGAAGGGAGTCAGG + Intergenic
1056753897 9:89370810-89370832 GTGTGGGTGTGGTGTGTGTCTGG + Intronic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056932827 9:90892942-90892964 CTGAGGTTGTGCAGGGAGCCAGG - Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057271075 9:93651817-93651839 TTGAGGGTGTGGTGGGAGGCAGG + Intronic
1057298937 9:93865466-93865488 CTGTGGGGGTGCGGGGAGCCAGG - Intergenic
1057448731 9:95137748-95137770 CTCTGAGTGTGGAGGCAGGCAGG + Intronic
1057669502 9:97076232-97076254 CTGTGGGTCTGGAGGAACCCGGG + Intergenic
1057921267 9:99099547-99099569 CTGTGAGTGTGGGTGAAGTCAGG + Intergenic
1058704936 9:107630256-107630278 CTCTGCCTGTGGAGGGAGGCTGG + Intergenic
1058767128 9:108192467-108192489 CTGAGGGTGGGGAGAGAATCAGG - Intergenic
1060041938 9:120307696-120307718 CTCTGGGGGTGAGGGGAGTCAGG - Intergenic
1060468097 9:123925496-123925518 GTTTTGGTGGGGAGGGAGTCTGG + Intronic
1060661984 9:125409648-125409670 CTGTGTGTGTGGTGTGTGTCTGG - Intergenic
1061002382 9:127909847-127909869 CTGTGGGGGCAGAGGGAGTGTGG - Intronic
1061033655 9:128101684-128101706 CTGTGCGTGTGGAGGGGGCGGGG + Intronic
1061227863 9:129291192-129291214 CTAGGGGTGGGGAGGGATTCCGG - Intergenic
1061725815 9:132581380-132581402 CTGTGGGCCTGGCGGGAGTGGGG - Intergenic
1061728077 9:132592216-132592238 CTGTCGCTGTGGGGGGAGTGGGG - Intergenic
1061931233 9:133834195-133834217 CTGGTGGTGTCCAGGGAGTCAGG - Intronic
1062391670 9:136336358-136336380 CTGGGGGTGTGGAGGGATTCGGG - Intronic
1062626466 9:137445082-137445104 CTTTGGGTGTGGAGGAATTCTGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186349282 X:8727214-8727236 GTGAGGGTGCGGTGGGAGTCAGG - Intronic
1186664683 X:11705098-11705120 CTGTGTGTGGGGAGAGAGCCAGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187929790 X:24283515-24283537 CAGTGGGGGTGGGGGTAGTCAGG + Intergenic
1188574636 X:31632117-31632139 GTGTGTGTGTGGCGGGAGTAGGG - Intronic
1189075054 X:37905950-37905972 CTGGGGGTGGGGAGGGAGAGGGG + Intronic
1189333136 X:40155054-40155076 CTGCGGGAGGGGAGGGGGTCGGG + Intronic
1190110051 X:47583489-47583511 CTGTGGGTGGGGTGGGACACAGG - Exonic
1190731704 X:53230871-53230893 CTGGAGGGGTGGAGGGAGTGAGG + Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1195272226 X:103243103-103243125 CTGTGTGTATGGTGGGAGTGTGG - Intergenic
1195644218 X:107209981-107210003 CTGTGGGTCTGGAGCCAATCTGG + Intronic
1195975573 X:110522477-110522499 CTGCGTGTGTGCAGGGAGACTGG + Intergenic
1196569622 X:117250290-117250312 GTGTGGATGTGTATGGAGTCAGG - Intergenic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1199678075 X:150204830-150204852 CAGGGGGTGGGGAGGGAGCCTGG - Intergenic
1200090653 X:153634357-153634379 CAGTGGGTGGGGAGTGGGTCAGG - Intergenic
1200090767 X:153634937-153634959 ATGTGGGCCTGGAGGAAGTCGGG + Intergenic
1201438553 Y:13985362-13985384 TGGTGGGTGGGGAGGGAGTGAGG - Intergenic
1201438571 Y:13985416-13985438 GGGTGGGTGGGGAGGGAGTGAGG - Intergenic
1201446002 Y:14057292-14057314 GGGTGGGTGGGGAGGGAGTGAGG + Intergenic
1201446020 Y:14057346-14057368 TGGTGGGTGGGGAGGGAGTGAGG + Intergenic
1201595150 Y:15660016-15660038 CTGGGAGTGTGGTGGGAGTAGGG - Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic