ID: 1184960167

View in Genome Browser
Species Human (GRCh38)
Location 22:47922918-47922940
Sequence CATCTGCATGGAGCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184960167_1184960177 11 Left 1184960167 22:47922918-47922940 CCCTGGGGTGCTCCATGCAGATG 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1184960177 22:47922952-47922974 GGGCCATCATCTCCATCCTATGG 0: 1
1: 0
2: 1
3: 6
4: 140
1184960167_1184960175 -9 Left 1184960167 22:47922918-47922940 CCCTGGGGTGCTCCATGCAGATG 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1184960175 22:47922932-47922954 ATGCAGATGGACTGGGGCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 263
1184960167_1184960174 -10 Left 1184960167 22:47922918-47922940 CCCTGGGGTGCTCCATGCAGATG 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1184960174 22:47922931-47922953 CATGCAGATGGACTGGGGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184960167 Original CRISPR CATCTGCATGGAGCACCCCA GGG (reversed) Intergenic
900469765 1:2847957-2847979 CCTCTGCCTGGGGCAGCCCAGGG + Intergenic
900572528 1:3365537-3365559 CAACCCCATGGATCACCCCATGG - Intronic
901435592 1:9245567-9245589 CATCAGCATGGAGCCTGCCAGGG + Intronic
903817549 1:26075787-26075809 CCTCTGCTTGGAGCACCCTCAGG + Intergenic
905205834 1:36342396-36342418 CATCTGCCTAGACCATCCCAGGG - Intronic
906188049 1:43876724-43876746 CACATGCAATGAGCACCCCATGG - Intronic
907383612 1:54111126-54111148 CATATGCATGGAGCCCTGCATGG - Intronic
907678500 1:56541096-56541118 CATATGCATAGAGTACACCAAGG + Intronic
910628329 1:89332161-89332183 AGTCTTCATGGAGCACTCCAGGG + Intergenic
913991469 1:143616772-143616794 CCCCTCCATGGAGCATCCCACGG + Intergenic
914212802 1:145596316-145596338 CCCCTCCATGGAGCATCCCATGG + Intergenic
914382734 1:147132858-147132880 CCCCTCCATGGAGCATCCCATGG + Intergenic
917503735 1:175609568-175609590 CATCTGCAGGGTGCCCCCTAAGG - Intronic
919926988 1:202196725-202196747 CACCTCCATGGAGCACCCATAGG - Intronic
920961146 1:210665125-210665147 CATGTGCATAGTGCACCCCATGG + Intronic
920986650 1:210897030-210897052 CTTCTGGAAGGAGCACTCCATGG + Intronic
921358228 1:214306367-214306389 CATCTGACTGTAGCGCCCCAGGG + Intronic
923037121 1:230292112-230292134 CACCTGCTTGGAGCATCCAAGGG - Intergenic
1063696800 10:8343612-8343634 CATCTGCATGGTGCACACTGAGG + Intergenic
1067090734 10:43264770-43264792 TCTCTGCATGGCCCACCCCAGGG - Intronic
1067234115 10:44434261-44434283 CACATCCAAGGAGCACCCCATGG - Intergenic
1068664031 10:59653548-59653570 AATCTGCATGGAACATCTCATGG - Intronic
1069330265 10:67283527-67283549 CATCTGGATGGCCCACCGCAAGG + Intronic
1069551295 10:69366345-69366367 CACTTGCAGGGAGCACCCCTGGG + Intronic
1069633527 10:69911961-69911983 CATCTGCACGGAGCACTCAGTGG - Intronic
1070400696 10:76051057-76051079 CCCCTGCATGGAGCAGCCCTGGG + Intronic
1070680973 10:78448774-78448796 CATTTGCATGGAACAGCCAAGGG + Intergenic
1072552051 10:96486717-96486739 CATCTGTAGAGAGCACCCCTGGG + Intronic
1076347317 10:129788360-129788382 CCTCTGCACAGGGCACCCCAGGG - Intergenic
1077209865 11:1365014-1365036 CAGCTGCTTGTAGCACCTCAGGG + Intergenic
1077226221 11:1440142-1440164 CAGCTGCATGCAGCGTCCCACGG + Intronic
1077762974 11:5123569-5123591 CATAAGCATGGAGAACTCCAAGG - Intergenic
1078188116 11:9069433-9069455 CATCTGCAAGGAGGCCCCAAGGG - Exonic
1078405547 11:11067429-11067451 CAACTTCCTGGAGCTCCCCATGG - Intergenic
1078633893 11:13030977-13030999 CGTTTGCATGGAGCAGCACAGGG - Intergenic
1079180890 11:18192602-18192624 CCACTGCATGTAGCACTCCAAGG - Intronic
1079239756 11:18714180-18714202 CATTGGCATGGAGGAGCCCATGG + Intronic
1079259917 11:18868473-18868495 CTTCTGTATGCAGAACCCCAAGG + Intergenic
1082981615 11:59129088-59129110 CATCTGAATGCAGCTCCCCATGG + Intergenic
1082989092 11:59192106-59192128 CATCTGTATGGAACGCCTCACGG + Exonic
1084473928 11:69378182-69378204 CATCTCCAGGGAGAAGCCCATGG - Intergenic
1085350222 11:75793449-75793471 CATCTTCATCCAGCAGCCCAGGG + Intronic
1085519983 11:77132033-77132055 CATTTTCATGGAGCTCCACATGG - Intronic
1086236654 11:84639718-84639740 CATTGGCATTGAGCAACCCAGGG - Intronic
1090085690 11:123648938-123648960 CATTTGCATGGAGCAGCAGAAGG + Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090793455 11:130112874-130112896 TATCAGCATCGACCACCCCAGGG + Intronic
1090854022 11:130596405-130596427 CATCTGTATATAGCAACCCAAGG + Intergenic
1094852492 12:34388541-34388563 CATGACCATGGAGCACCTCAGGG - Intergenic
1094870314 12:34595966-34595988 CATGTCCATGGAGCATCTCAGGG + Intergenic
1095739673 12:45593301-45593323 CATCTGCATTCCGCACACCAGGG + Intergenic
1097033073 12:56103895-56103917 CACCTGGATGGAGCACCTAAGGG - Intronic
1099274841 12:80561521-80561543 CATCTCCATGGTTCACTCCAGGG + Intronic
1102083312 12:110115800-110115822 CATCTGCATGGATGACCTCAGGG + Intergenic
1103443856 12:120981311-120981333 CACCAACATGGGGCACCCCAGGG - Intronic
1104358421 12:128109711-128109733 CATCTGCAGGGAGCACTTGAAGG - Intergenic
1104536737 12:129624708-129624730 GACCTGCATGGAGCACAGCATGG - Intronic
1104536756 12:129624842-129624864 GACCTGCATGGAGCACAGCATGG - Intronic
1105841637 13:24258987-24259009 CATATGGATGGTCCACCCCAAGG - Intronic
1108591557 13:51917153-51917175 CATCACCATGGAGCTCCACAGGG + Intergenic
1108694996 13:52895400-52895422 CATCAGCATGGAGCAGTGCATGG - Intergenic
1109945365 13:69424584-69424606 CATATCCAGGGAGCACCCCATGG + Intergenic
1114668641 14:24397461-24397483 CATCTTCATGGAGAACTCCTGGG - Intergenic
1115289264 14:31751911-31751933 CAACTGCATGGAGGCCACCAAGG + Intronic
1115740604 14:36383741-36383763 CATCTACATGCAGCACACAAAGG - Intergenic
1117347055 14:54843148-54843170 CATCTACATGGATCACACAAAGG + Exonic
1119323291 14:73744127-73744149 CATCAGCATTGAACACCCAAAGG - Intronic
1119404684 14:74390274-74390296 CCTCTCCATGGAGGACCACATGG + Intergenic
1121150610 14:91630284-91630306 TCTCTTCCTGGAGCACCCCAGGG + Intronic
1121210920 14:92207467-92207489 CATCCTCATGGAGCCCCCCTGGG - Intergenic
1121917946 14:97853443-97853465 CATCTGCAGGAGGCTCCCCAGGG - Intergenic
1121928315 14:97949052-97949074 CCTCTGCCTGGAGCGCCCCGGGG - Intronic
1123035721 14:105471138-105471160 CCTCTGGCTGGAGCACTCCAAGG - Intergenic
1202848314 14_GL000225v1_random:287-309 TCTCTGCATTGATCACCCCAGGG + Intergenic
1127296681 15:57614717-57614739 CGTCTCCATGTAGCATCCCAGGG - Intronic
1127826623 15:62709380-62709402 CCTCTGCGTGGATCACCCCAGGG - Intronic
1128749819 15:70140836-70140858 CGTCTGCAGGAAGCACCCCGGGG - Intergenic
1128989682 15:72249295-72249317 AAGCTGCATGGAGCAGCCTATGG - Exonic
1130064188 15:80591268-80591290 CAAGTGCAAGGAGCACTCCAAGG + Intronic
1130370124 15:83278304-83278326 TATCTCCATGAAGCTCCCCATGG - Intronic
1131417532 15:92273566-92273588 GCTCTGGCTGGAGCACCCCAAGG + Intergenic
1132690061 16:1178180-1178202 CCTCTCCATGGGGCACCTCATGG + Intronic
1132761565 16:1510988-1511010 CAACAGCATGGAGGACGCCAGGG - Exonic
1132986008 16:2768022-2768044 CATCAGAGTGGGGCACCCCAGGG - Exonic
1133102125 16:3485978-3486000 CAGCTGAATGGAGCATGCCAAGG - Exonic
1133130659 16:3674470-3674492 CATCTGGATGATGGACCCCAAGG - Exonic
1135307105 16:21376781-21376803 CATGTGCAGGTAGCACTCCAGGG - Intergenic
1136265869 16:29117826-29117848 CATCTGCAGGGACCGCCCCCCGG - Intergenic
1142128465 16:88421562-88421584 CATTTGCCTGCAGCACCCCAGGG - Intergenic
1142307924 16:89295799-89295821 CACCTGCACAGAGCACCCCTCGG - Intronic
1142307938 16:89295846-89295868 CACCTGCACAGAGCACCCCAAGG - Intronic
1142307953 16:89295897-89295919 CACCTGCACAGAGCACCCCCAGG - Intronic
1142622670 17:1174916-1174938 GATCTGCTTGGAGAATCCCAGGG + Intronic
1144675800 17:17160826-17160848 CATCTGGAGGAAGCACCCCATGG - Intronic
1145265241 17:21376768-21376790 CCTCGGCATGGAGCGCCCCCGGG + Exonic
1146735839 17:35238113-35238135 CATCAGCTGGGAGCAGCCCATGG + Intergenic
1146788733 17:35739564-35739586 CATCTCCCTGGAGCTGCCCAGGG + Intronic
1147625864 17:41899480-41899502 CCTCTGCGTGGAGCTCTCCATGG + Intronic
1148863949 17:50618987-50619009 CTTTTCCCTGGAGCACCCCACGG + Exonic
1149470817 17:56913925-56913947 CATCTGCCTGGAGCCCTTCAAGG - Exonic
1151450810 17:74197156-74197178 CATCTGTCTGGAGCATCCCGAGG + Intergenic
1151499252 17:74478393-74478415 CAGCTGCAACGGGCACCCCAGGG + Intronic
1153799194 18:8654408-8654430 CAGCTGCATGAAGAAACCCATGG + Intergenic
1154151054 18:11906983-11907005 CATCTGCATGGACCCCACCAAGG + Intronic
1154493009 18:14935441-14935463 CATGTGCATCCAGCAGCCCAAGG + Intergenic
1156405386 18:36778193-36778215 CATCTGCAGGCCACACCCCATGG - Intronic
1156854968 18:41771087-41771109 GACCTGTATGGAGCTCCCCATGG - Intergenic
1158334495 18:56400917-56400939 CATCTGGATGATGCATCCCACGG - Intergenic
1159485935 18:69057351-69057373 CAGCTGCAAGAATCACCCCATGG - Intergenic
1160219869 18:76966919-76966941 AAAATGCATGGAGCACACCAAGG - Intronic
1161064872 19:2232683-2232705 CTTCTGCTAGGAGCACCCCTAGG - Intronic
1164446490 19:28322156-28322178 CAACTGCTTGCAACACCCCAGGG + Intergenic
1165111134 19:33502981-33503003 AATGTGCCTGGAGAACCCCACGG + Intronic
1165453271 19:35897172-35897194 CATCTGCATGCAGAGCCCCTGGG + Intronic
1166321383 19:42021354-42021376 CTGCTGCATGAAGCCCCCCACGG + Exonic
1168326550 19:55541436-55541458 CATCTGCGTGGACCAGCCCCCGG + Exonic
1168468470 19:56622442-56622464 CATCTGCAAGAAGCACTTCACGG + Exonic
926188402 2:10709220-10709242 CATCTGCCTGGCTCACCACATGG - Intergenic
928236564 2:29547010-29547032 GAGCTGCATGGAGCACCCATGGG + Intronic
929172358 2:38944705-38944727 CATCTGCATGGAGTCCCCATGGG + Intronic
929433572 2:41909229-41909251 CATCTGCAAGGAGTACATCAGGG + Intergenic
932083791 2:68739401-68739423 CATCTTCATGTAGCATCCAATGG + Intronic
932134301 2:69214804-69214826 GAGCTCCAAGGAGCACCCCAGGG - Intronic
932751916 2:74376650-74376672 CACATGCATGCAGCAGCCCAGGG + Intronic
933234266 2:79847660-79847682 CATCTGCATGATGCCCTCCAAGG + Intronic
935810963 2:106796731-106796753 CGGCTGCATGGAACTCCCCAAGG + Intergenic
939080969 2:137661791-137661813 CATGTGGATGGCGCACCCTAAGG - Intronic
945011225 2:205465952-205465974 TTTCTGTATGGAGAACCCCATGG - Intronic
947394120 2:229670513-229670535 CAGTTTCATGGAGAACCCCAAGG - Intronic
948180582 2:235976751-235976773 CAGCTGCCTGGAGGACCTCAGGG + Intronic
1169747953 20:8962344-8962366 CAACGGCATGCAGCACCCCTAGG - Intronic
1169993884 20:11534970-11534992 CAGCTACATGGAGGACCTCAAGG + Intergenic
1171146465 20:22788143-22788165 CTTCAGGATGGAGCACACCAGGG + Intergenic
1172158682 20:32848975-32848997 CATCCGCATGGTGAGCCCCACGG - Exonic
1172884285 20:38221086-38221108 CATCTGACTGCAGCTCCCCACGG + Intronic
1175371689 20:58496746-58496768 CTTCTGCCTGTAACACCCCAAGG - Intronic
1175811525 20:61860949-61860971 GATCAGCATGCAGCCCCCCAGGG + Intronic
1177863264 21:26480329-26480351 CATGTGCATGAAGAACCACAGGG - Exonic
1178732957 21:35121266-35121288 CACATTCAGGGAGCACCCCATGG + Intronic
1179467748 21:41589071-41589093 CACCTCAAGGGAGCACCCCATGG - Intergenic
1181911825 22:26244557-26244579 CATCTGCATTGAGCGCTCTAAGG + Intronic
1182791925 22:32960287-32960309 CATCTGCCCTGATCACCCCAGGG + Intronic
1183545786 22:38454388-38454410 CGTGTGTAGGGAGCACCCCAAGG - Intronic
1184422698 22:44391166-44391188 CATATGGATGTATCACCCCAGGG - Intergenic
1184960167 22:47922918-47922940 CATCTGCATGGAGCACCCCAGGG - Intergenic
1185357266 22:50381219-50381241 CCTCAGCATGGGGCACCACACGG + Intronic
950135463 3:10577652-10577674 CATCTACATTGTGCAGCCCAGGG - Intronic
950887415 3:16373896-16373918 CATCTGGATGGAGCAGCCTGGGG - Intronic
952108213 3:30092994-30093016 CATGTGCATGCAGCACCCAACGG - Intergenic
953251042 3:41246060-41246082 CATCTGGTTGGAGCTGCCCAGGG + Intronic
953377533 3:42441195-42441217 CACCTGCAGGGAGCATTCCATGG + Intergenic
954138265 3:48592246-48592268 CACCTGCATGGGGGACACCAAGG + Exonic
954149783 3:48651628-48651650 CACCTGCCAGGAGCCCCCCATGG - Exonic
955146854 3:56328154-56328176 CTTCTGCATGGAGCCCTCCCTGG - Intronic
958767240 3:98384063-98384085 CATATGCATGGGTCACTCCATGG + Intergenic
959125820 3:102289856-102289878 CACATCAATGGAGCACCCCATGG - Intronic
961318105 3:126054350-126054372 CAGCTCCATGGACCACCTCAAGG - Intronic
968665943 4:1822458-1822480 CAGCTGCATGGAGCCTCCCTAGG - Intronic
977681096 4:99799312-99799334 CACCTGTTTGGAGCTCCCCAAGG - Intergenic
980065809 4:128187307-128187329 CATAGGCATGGAGCTGCCCAAGG + Intronic
981237851 4:142439009-142439031 CATCTGAGTGGTGCACCCCATGG - Intronic
981904075 4:149900500-149900522 CATATGCATGCAGCCCCCAAAGG - Intergenic
981904453 4:149904670-149904692 CATATGCATGCAGCCCCCAAAGG - Intergenic
982353692 4:154444085-154444107 CTTCTGCATGGCCCAGCCCATGG + Intronic
984388463 4:179096026-179096048 CATGTTCATGGAGCTCTCCATGG - Intergenic
985005057 4:185526110-185526132 CACCTGCATGGAGCAGGGCATGG + Intronic
985063568 4:186101317-186101339 CATCAGCCTGGAGCACCCTTCGG + Intergenic
985708315 5:1414277-1414299 CATCTGCAGGGAGCAGTCGAGGG + Intronic
985813619 5:2110548-2110570 CACCTGCAGGGACCACCCGATGG + Intergenic
986025450 5:3846302-3846324 CATCTACCTGGAACACCCCTTGG - Intergenic
992889933 5:81194738-81194760 CATCTGCAAGGGGCCCCCCTTGG - Intronic
994692095 5:103032458-103032480 CATCTCCACGTAGCACTCCAGGG - Intergenic
995881819 5:116851784-116851806 TTTCAGCATGGAGCACCCCCAGG - Intergenic
999440796 5:151599113-151599135 CACCTGCATGGATCACATCAGGG - Intergenic
999945400 5:156590307-156590329 CATCTACATGCAGCACTCCAGGG - Intronic
1007694288 6:43722241-43722263 CACCTCCATGGAGCAGCCGAGGG + Intergenic
1007992697 6:46274002-46274024 CAGCTGAATGGAGCACAGCATGG + Intronic
1012299142 6:97563191-97563213 CATATCAAGGGAGCACCCCATGG - Intergenic
1016216228 6:141607444-141607466 CATATCAAGGGAGCACCCCAAGG - Intergenic
1016901596 6:149108390-149108412 GAGCTGCTTGGAGCAACCCATGG + Intergenic
1019019139 6:168902870-168902892 GAGCTGCATGGAGCATCCCAGGG + Intergenic
1019123821 6:169825843-169825865 CATGTCAAGGGAGCACCCCATGG - Intergenic
1019540588 7:1549502-1549524 CATCTGCGCCGAGGACCCCAGGG - Intronic
1019671697 7:2283423-2283445 CATCGGCACGGGGAACCCCAGGG - Intronic
1021534545 7:21688567-21688589 CAACTGCCTGGGGCATCCCAAGG + Intronic
1021605308 7:22403864-22403886 CAACTGCATGGGGCACCTCTGGG + Intergenic
1025015315 7:55434754-55434776 CTTCTGCATCGAGCACCCAGGGG - Intergenic
1025261177 7:57418090-57418112 CATCTGCATGGAGCCGGCCTGGG - Intergenic
1025738492 7:64175300-64175322 CATCTGCATGGAGCCGGCCTGGG - Intronic
1027359404 7:77392695-77392717 CATGTGCCTGGATCACACCATGG - Intronic
1028444088 7:90899323-90899345 TATCTGGATGCAGCCCCCCAGGG - Exonic
1030796191 7:113790921-113790943 CATCTGCTAGGAACACCCCCTGG + Intergenic
1032394154 7:131576946-131576968 CATCTGCATTGAGCACAGGAAGG + Intergenic
1032550893 7:132783254-132783276 CATCAGCAGGGAGCTCTCCAAGG + Intergenic
1034982348 7:155487262-155487284 CATCTCCTGGGAGCTCCCCAGGG - Intronic
1035736843 8:1894599-1894621 CAGGTGCATGGAGAGCCCCATGG - Intronic
1036961409 8:13248660-13248682 CTTCTGAAGGAAGCACCCCAGGG - Intronic
1037749092 8:21668346-21668368 AATCTCCATGGAGCACTGCAGGG - Intergenic
1037888390 8:22607223-22607245 CTTCTGCATGTAGCAGCCCTGGG + Exonic
1038658722 8:29478036-29478058 CATCTGCATGGTGCTGGCCATGG + Intergenic
1038686298 8:29721724-29721746 CTGCAGCATTGAGCACCCCAGGG + Intergenic
1041009864 8:53531071-53531093 CATGTGCATGTAGTACCCCAAGG - Intergenic
1041409764 8:57540658-57540680 CATGTGGATGGCCCACCCCAAGG - Intergenic
1044622926 8:94208357-94208379 CATCTGCATAGCCCACCTCAAGG + Intronic
1045033115 8:98156272-98156294 CACATCCATAGAGCACCCCAGGG + Exonic
1047069397 8:121326174-121326196 CATCTGCATAAATCAACCCATGG - Intergenic
1047801350 8:128313894-128313916 TTTCTGAATGGAGCTCCCCATGG + Intergenic
1048195344 8:132327828-132327850 CATGTGCATGAAGCCCCCCATGG + Intronic
1048568081 8:135624916-135624938 CATCTGCATGGTGAGCCCCACGG + Intronic
1049073237 8:140373173-140373195 CATTAGCATGGAGGCCCCCAGGG - Intronic
1049366256 8:142238254-142238276 CCTCTGCAGGCAGCAACCCAGGG + Intronic
1049645176 8:143732963-143732985 TATCTGGAAGGAGGACCCCATGG + Intronic
1049681315 8:143919722-143919744 CATCTACCTGGAGGACACCAAGG - Exonic
1050483530 9:6110511-6110533 CATCTGCATGAAGCCCACAAAGG - Intergenic
1051179083 9:14391689-14391711 CATGTGCATAGCCCACCCCAAGG + Intronic
1051888722 9:21922280-21922302 CATGTGGATGGCCCACCCCAAGG + Intronic
1052027318 9:23588079-23588101 CCTCTGCATGGAGCACCCTCTGG + Intergenic
1052279974 9:26721481-26721503 CATTTGCCTGGAGCAGTCCATGG - Intergenic
1056534671 9:87517088-87517110 CACCTGCAGGGAGCCACCCAGGG + Intronic
1057411545 9:94820335-94820357 CATCTGCATGAAGGAACACAGGG - Intronic
1057964492 9:99489947-99489969 TATCTGCATGGAGGAAGCCATGG - Intergenic
1062090790 9:134677843-134677865 CAGCTGCCTGGAACGCCCCATGG + Intronic
1062437636 9:136553659-136553681 CGACTGCATGGAGCCCCCCCGGG + Intergenic
1193563446 X:83048158-83048180 CATCTTCACTGAGGACCCCAGGG + Intergenic
1193817465 X:86121611-86121633 CACATCCAGGGAGCACCCCATGG - Intergenic
1198292052 X:135249195-135249217 CATCTGCATGGAGCATCAGGAGG - Intronic
1198825737 X:140696226-140696248 CAGAGGCATGGAGCTCCCCAAGG - Intergenic
1199996480 X:153029675-153029697 GAGCTGGATGGAGCACGCCAAGG + Intergenic
1200447878 Y:3287938-3287960 CACATCCAGGGAGCACCCCATGG - Intergenic