ID: 1184964620

View in Genome Browser
Species Human (GRCh38)
Location 22:47962138-47962160
Sequence TTGAATATACAGATGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184964620_1184964624 6 Left 1184964620 22:47962138-47962160 CCCAGATTCATCTGTATATTCAA No data
Right 1184964624 22:47962167-47962189 CCCAGTGGATTTGATGTGAATGG No data
1184964620_1184964627 30 Left 1184964620 22:47962138-47962160 CCCAGATTCATCTGTATATTCAA No data
Right 1184964627 22:47962191-47962213 TGAATGTGCAGATGTGTGGATGG No data
1184964620_1184964622 -9 Left 1184964620 22:47962138-47962160 CCCAGATTCATCTGTATATTCAA No data
Right 1184964622 22:47962152-47962174 TATATTCAACAGAATCCCAGTGG No data
1184964620_1184964626 26 Left 1184964620 22:47962138-47962160 CCCAGATTCATCTGTATATTCAA No data
Right 1184964626 22:47962187-47962209 TGGATGAATGTGCAGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184964620 Original CRISPR TTGAATATACAGATGAATCT GGG (reversed) Intergenic
No off target data available for this crispr