ID: 1184965505

View in Genome Browser
Species Human (GRCh38)
Location 22:47969237-47969259
Sequence CTAGTTCTGGCACCTCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184965502_1184965505 -1 Left 1184965502 22:47969215-47969237 CCAAACACTGCACTTTTATTTGC No data
Right 1184965505 22:47969237-47969259 CTAGTTCTGGCACCTCTCATGGG No data
1184965501_1184965505 0 Left 1184965501 22:47969214-47969236 CCCAAACACTGCACTTTTATTTG No data
Right 1184965505 22:47969237-47969259 CTAGTTCTGGCACCTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184965505 Original CRISPR CTAGTTCTGGCACCTCTCAT GGG Intergenic
No off target data available for this crispr