ID: 1184970577

View in Genome Browser
Species Human (GRCh38)
Location 22:48017042-48017064
Sequence GAGTGAGCCACACGTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184970577_1184970585 -3 Left 1184970577 22:48017042-48017064 CCACCCACACGTGTGGCTCACTC No data
Right 1184970585 22:48017062-48017084 CTCTGGGCATAGGGAGACTCGGG No data
1184970577_1184970592 30 Left 1184970577 22:48017042-48017064 CCACCCACACGTGTGGCTCACTC No data
Right 1184970592 22:48017095-48017117 CCTGGTCTGAGTCCAACCAAGGG No data
1184970577_1184970584 -4 Left 1184970577 22:48017042-48017064 CCACCCACACGTGTGGCTCACTC No data
Right 1184970584 22:48017061-48017083 ACTCTGGGCATAGGGAGACTCGG No data
1184970577_1184970586 5 Left 1184970577 22:48017042-48017064 CCACCCACACGTGTGGCTCACTC No data
Right 1184970586 22:48017070-48017092 ATAGGGAGACTCGGGCAACCTGG No data
1184970577_1184970590 29 Left 1184970577 22:48017042-48017064 CCACCCACACGTGTGGCTCACTC No data
Right 1184970590 22:48017094-48017116 CCCTGGTCTGAGTCCAACCAAGG No data
1184970577_1184970587 12 Left 1184970577 22:48017042-48017064 CCACCCACACGTGTGGCTCACTC No data
Right 1184970587 22:48017077-48017099 GACTCGGGCAACCTGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184970577 Original CRISPR GAGTGAGCCACACGTGTGGG TGG (reversed) Intergenic
No off target data available for this crispr