ID: 1184971561

View in Genome Browser
Species Human (GRCh38)
Location 22:48025770-48025792
Sequence GTCCCTGAGGACCAGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184971554_1184971561 20 Left 1184971554 22:48025727-48025749 CCTGCCACGGAACTGCAAGTGGA No data
Right 1184971561 22:48025770-48025792 GTCCCTGAGGACCAGAGTGCAGG No data
1184971555_1184971561 16 Left 1184971555 22:48025731-48025753 CCACGGAACTGCAAGTGGAAGTG No data
Right 1184971561 22:48025770-48025792 GTCCCTGAGGACCAGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184971561 Original CRISPR GTCCCTGAGGACCAGAGTGC AGG Intergenic
No off target data available for this crispr