ID: 1184972274

View in Genome Browser
Species Human (GRCh38)
Location 22:48033209-48033231
Sequence CTTTGGAAGGGTGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184972274_1184972281 -8 Left 1184972274 22:48033209-48033231 CCATCCACCTCACCCTTCCAAAG No data
Right 1184972281 22:48033224-48033246 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184972274 Original CRISPR CTTTGGAAGGGTGAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr