ID: 1184974433

View in Genome Browser
Species Human (GRCh38)
Location 22:48051078-48051100
Sequence CAGCATGACTGGAGAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184974428_1184974433 -10 Left 1184974428 22:48051065-48051087 CCCAAATTGGCCTCAGCATGACT No data
Right 1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG No data
1184974427_1184974433 -9 Left 1184974427 22:48051064-48051086 CCCCAAATTGGCCTCAGCATGAC No data
Right 1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184974433 Original CRISPR CAGCATGACTGGAGAGAAAT GGG Intergenic
No off target data available for this crispr