ID: 1184974478 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:48051383-48051405 |
| Sequence | CCTGGGAGGCAGAAGTTGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4891 | |||
| Summary | {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1184974471_1184974478 | 16 | Left | 1184974471 | 22:48051344-48051366 | CCAGCTACTCAGGAGGCTGAGGC | 0: 84870 1: 190808 2: 228673 3: 158767 4: 94038 |
||
| Right | 1184974478 | 22:48051383-48051405 | CCTGGGAGGCAGAAGTTGCAGGG | 0: 18 1: 262 2: 800 3: 1509 4: 2302 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1184974478 | Original CRISPR | CCTGGGAGGCAGAAGTTGCA GGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||