ID: 1184974478

View in Genome Browser
Species Human (GRCh38)
Location 22:48051383-48051405
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184974471_1184974478 16 Left 1184974471 22:48051344-48051366 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184974478 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intergenic
Too many off-targets to display for this crispr