ID: 1184975495

View in Genome Browser
Species Human (GRCh38)
Location 22:48058676-48058698
Sequence TGTTTGGAAAGAACTTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184975495_1184975508 29 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975495_1184975505 22 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975505 22:48058721-48058743 GAAACTCCAGGGTAAAGATAAGG No data
1184975495_1184975499 -4 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975499 22:48058695-48058717 AACAAAGTAAACTTCCCACCTGG No data
1184975495_1184975507 28 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975507 22:48058727-48058749 CCAGGGTAAAGATAAGGTTGCGG No data
1184975495_1184975503 11 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975503 22:48058710-48058732 CCACCTGGAGAGAAACTCCAGGG No data
1184975495_1184975509 30 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975509 22:48058729-48058751 AGGGTAAAGATAAGGTTGCGGGG No data
1184975495_1184975501 10 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975501 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184975495 Original CRISPR TGTTTGGAAAGAACTTCCTG GGG (reversed) Intergenic
No off target data available for this crispr