ID: 1184975498

View in Genome Browser
Species Human (GRCh38)
Location 22:48058692-48058714
Sequence GGTGGGAAGTTTACTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184975498_1184975514 23 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975514 22:48058738-48058760 ATAAGGTTGCGGGGGAGGGCGGG No data
1184975498_1184975515 30 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975515 22:48058745-48058767 TGCGGGGGAGGGCGGGAAGAAGG No data
1184975498_1184975509 14 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975509 22:48058729-48058751 AGGGTAAAGATAAGGTTGCGGGG No data
1184975498_1184975513 22 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975513 22:48058737-48058759 GATAAGGTTGCGGGGGAGGGCGG No data
1184975498_1184975510 15 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975510 22:48058730-48058752 GGGTAAAGATAAGGTTGCGGGGG No data
1184975498_1184975501 -6 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975501 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
1184975498_1184975505 6 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975505 22:48058721-48058743 GAAACTCCAGGGTAAAGATAAGG No data
1184975498_1184975508 13 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975498_1184975511 18 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975511 22:48058733-48058755 TAAAGATAAGGTTGCGGGGGAGG No data
1184975498_1184975512 19 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975512 22:48058734-48058756 AAAGATAAGGTTGCGGGGGAGGG No data
1184975498_1184975507 12 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975507 22:48058727-48058749 CCAGGGTAAAGATAAGGTTGCGG No data
1184975498_1184975503 -5 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975503 22:48058710-48058732 CCACCTGGAGAGAAACTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184975498 Original CRISPR GGTGGGAAGTTTACTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr