ID: 1184975500

View in Genome Browser
Species Human (GRCh38)
Location 22:48058709-48058731
Sequence CCTGGAGTTTCTCTCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184975500_1184975507 -5 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975507 22:48058727-48058749 CCAGGGTAAAGATAAGGTTGCGG No data
1184975500_1184975508 -4 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975500_1184975512 2 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975512 22:48058734-48058756 AAAGATAAGGTTGCGGGGGAGGG No data
1184975500_1184975511 1 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975511 22:48058733-48058755 TAAAGATAAGGTTGCGGGGGAGG No data
1184975500_1184975513 5 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975513 22:48058737-48058759 GATAAGGTTGCGGGGGAGGGCGG No data
1184975500_1184975509 -3 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975509 22:48058729-48058751 AGGGTAAAGATAAGGTTGCGGGG No data
1184975500_1184975515 13 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975515 22:48058745-48058767 TGCGGGGGAGGGCGGGAAGAAGG No data
1184975500_1184975510 -2 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975510 22:48058730-48058752 GGGTAAAGATAAGGTTGCGGGGG No data
1184975500_1184975516 24 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975516 22:48058756-48058778 GCGGGAAGAAGGCCAAGTCCAGG No data
1184975500_1184975514 6 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975514 22:48058738-48058760 ATAAGGTTGCGGGGGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184975500 Original CRISPR CCTGGAGTTTCTCTCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr