ID: 1184975508

View in Genome Browser
Species Human (GRCh38)
Location 22:48058728-48058750
Sequence CAGGGTAAAGATAAGGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184975495_1184975508 29 Left 1184975495 22:48058676-48058698 CCCCAGGAAGTTCTTTCCAAACA No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975496_1184975508 28 Left 1184975496 22:48058677-48058699 CCCAGGAAGTTCTTTCCAAACAA No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975504_1184975508 -8 Left 1184975504 22:48058713-48058735 CCTGGAGAGAAACTCCAGGGTAA No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975500_1184975508 -4 Left 1184975500 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975498_1184975508 13 Left 1184975498 22:48058692-48058714 CCAAACAAAGTAAACTTCCCACC No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975502_1184975508 -5 Left 1184975502 22:48058710-48058732 CCACCTGGAGAGAAACTCCAGGG No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data
1184975497_1184975508 27 Left 1184975497 22:48058678-48058700 CCAGGAAGTTCTTTCCAAACAAA No data
Right 1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184975508 Original CRISPR CAGGGTAAAGATAAGGTTGC GGG Intergenic
No off target data available for this crispr