ID: 1184978206

View in Genome Browser
Species Human (GRCh38)
Location 22:48078129-48078151
Sequence CTGGAAAAGCAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184978206_1184978213 10 Left 1184978206 22:48078129-48078151 CCTTCCTGCTTCTGCTTTTCCAG No data
Right 1184978213 22:48078162-48078184 CCCCGGACATTCCTGATACGTGG No data
1184978206_1184978210 -7 Left 1184978206 22:48078129-48078151 CCTTCCTGCTTCTGCTTTTCCAG No data
Right 1184978210 22:48078145-48078167 TTTCCAGCTTCTGGTGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184978206 Original CRISPR CTGGAAAAGCAGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr