ID: 1184978384

View in Genome Browser
Species Human (GRCh38)
Location 22:48079257-48079279
Sequence CTGACTGAAGCCCCTATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184978378_1184978384 13 Left 1184978378 22:48079221-48079243 CCACACACACAGCGAGTAACTGG No data
Right 1184978384 22:48079257-48079279 CTGACTGAAGCCCCTATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184978384 Original CRISPR CTGACTGAAGCCCCTATTAT GGG Intergenic
No off target data available for this crispr