ID: 1184979002

View in Genome Browser
Species Human (GRCh38)
Location 22:48082702-48082724
Sequence GGAAATGAATGCACAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184979002_1184979006 0 Left 1184979002 22:48082702-48082724 CCCATGGCTGTGCATTCATTTCC No data
Right 1184979006 22:48082725-48082747 ACCATGCCCGAGATGGCCAGTGG No data
1184979002_1184979004 -7 Left 1184979002 22:48082702-48082724 CCCATGGCTGTGCATTCATTTCC No data
Right 1184979004 22:48082718-48082740 CATTTCCACCATGCCCGAGATGG No data
1184979002_1184979011 18 Left 1184979002 22:48082702-48082724 CCCATGGCTGTGCATTCATTTCC No data
Right 1184979011 22:48082743-48082765 AGTGGAAATTAATGTGCACACGG No data
1184979002_1184979012 19 Left 1184979002 22:48082702-48082724 CCCATGGCTGTGCATTCATTTCC No data
Right 1184979012 22:48082744-48082766 GTGGAAATTAATGTGCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184979002 Original CRISPR GGAAATGAATGCACAGCCAT GGG (reversed) Intergenic
No off target data available for this crispr