ID: 1184979004

View in Genome Browser
Species Human (GRCh38)
Location 22:48082718-48082740
Sequence CATTTCCACCATGCCCGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184979002_1184979004 -7 Left 1184979002 22:48082702-48082724 CCCATGGCTGTGCATTCATTTCC No data
Right 1184979004 22:48082718-48082740 CATTTCCACCATGCCCGAGATGG No data
1184979001_1184979004 -4 Left 1184979001 22:48082699-48082721 CCACCCATGGCTGTGCATTCATT No data
Right 1184979004 22:48082718-48082740 CATTTCCACCATGCCCGAGATGG No data
1184979003_1184979004 -8 Left 1184979003 22:48082703-48082725 CCATGGCTGTGCATTCATTTCCA No data
Right 1184979004 22:48082718-48082740 CATTTCCACCATGCCCGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184979004 Original CRISPR CATTTCCACCATGCCCGAGA TGG Intergenic
No off target data available for this crispr