ID: 1184979011

View in Genome Browser
Species Human (GRCh38)
Location 22:48082743-48082765
Sequence AGTGGAAATTAATGTGCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184979002_1184979011 18 Left 1184979002 22:48082702-48082724 CCCATGGCTGTGCATTCATTTCC No data
Right 1184979011 22:48082743-48082765 AGTGGAAATTAATGTGCACACGG No data
1184979005_1184979011 -3 Left 1184979005 22:48082723-48082745 CCACCATGCCCGAGATGGCCAGT No data
Right 1184979011 22:48082743-48082765 AGTGGAAATTAATGTGCACACGG No data
1184979007_1184979011 -6 Left 1184979007 22:48082726-48082748 CCATGCCCGAGATGGCCAGTGGA No data
Right 1184979011 22:48082743-48082765 AGTGGAAATTAATGTGCACACGG No data
1184979003_1184979011 17 Left 1184979003 22:48082703-48082725 CCATGGCTGTGCATTCATTTCCA No data
Right 1184979011 22:48082743-48082765 AGTGGAAATTAATGTGCACACGG No data
1184979001_1184979011 21 Left 1184979001 22:48082699-48082721 CCACCCATGGCTGTGCATTCATT No data
Right 1184979011 22:48082743-48082765 AGTGGAAATTAATGTGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184979011 Original CRISPR AGTGGAAATTAATGTGCACA CGG Intergenic
No off target data available for this crispr