ID: 1184979266

View in Genome Browser
Species Human (GRCh38)
Location 22:48084596-48084618
Sequence TTGGAGAGCGACTGGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184979259_1184979266 6 Left 1184979259 22:48084567-48084589 CCTGAGAGCCGATGGAGCGCAGG No data
Right 1184979266 22:48084596-48084618 TTGGAGAGCGACTGGTTGGCTGG No data
1184979262_1184979266 -2 Left 1184979262 22:48084575-48084597 CCGATGGAGCGCAGGATGGTTTT No data
Right 1184979266 22:48084596-48084618 TTGGAGAGCGACTGGTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184979266 Original CRISPR TTGGAGAGCGACTGGTTGGC TGG Intergenic
No off target data available for this crispr