ID: 1184980443

View in Genome Browser
Species Human (GRCh38)
Location 22:48091739-48091761
Sequence TCATGCCCACAGTTGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184980443_1184980452 17 Left 1184980443 22:48091739-48091761 CCCTGCACCAACTGTGGGCATGA No data
Right 1184980452 22:48091779-48091801 AGACCCCAGCCCCACCTGGAAGG No data
1184980443_1184980453 18 Left 1184980443 22:48091739-48091761 CCCTGCACCAACTGTGGGCATGA No data
Right 1184980453 22:48091780-48091802 GACCCCAGCCCCACCTGGAAGGG No data
1184980443_1184980454 19 Left 1184980443 22:48091739-48091761 CCCTGCACCAACTGTGGGCATGA No data
Right 1184980454 22:48091781-48091803 ACCCCAGCCCCACCTGGAAGGGG No data
1184980443_1184980448 -6 Left 1184980443 22:48091739-48091761 CCCTGCACCAACTGTGGGCATGA No data
Right 1184980448 22:48091756-48091778 GCATGAGCCATGTGGGAGTCCGG No data
1184980443_1184980451 13 Left 1184980443 22:48091739-48091761 CCCTGCACCAACTGTGGGCATGA No data
Right 1184980451 22:48091775-48091797 CCGGAGACCCCAGCCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184980443 Original CRISPR TCATGCCCACAGTTGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr