ID: 1184981081

View in Genome Browser
Species Human (GRCh38)
Location 22:48096481-48096503
Sequence ACTAGGCTGATCCACAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184981081_1184981085 -10 Left 1184981081 22:48096481-48096503 CCCACTCTGTGGATCAGCCTAGT No data
Right 1184981085 22:48096494-48096516 TCAGCCTAGTGAGGAGGATCTGG No data
1184981081_1184981088 24 Left 1184981081 22:48096481-48096503 CCCACTCTGTGGATCAGCCTAGT No data
Right 1184981088 22:48096528-48096550 CAGTGAGCAGCCAGCGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184981081 Original CRISPR ACTAGGCTGATCCACAGAGT GGG (reversed) Intergenic
No off target data available for this crispr