ID: 1184981534

View in Genome Browser
Species Human (GRCh38)
Location 22:48099281-48099303
Sequence CAGTTCTGGGAGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184981534_1184981543 4 Left 1184981534 22:48099281-48099303 CCACCTGCCCTCTCCCAGAACTG No data
Right 1184981543 22:48099308-48099330 GCTGGCACCCATGAAGGGCCAGG No data
1184981534_1184981542 -1 Left 1184981534 22:48099281-48099303 CCACCTGCCCTCTCCCAGAACTG No data
Right 1184981542 22:48099303-48099325 GAAGAGCTGGCACCCATGAAGGG No data
1184981534_1184981541 -2 Left 1184981534 22:48099281-48099303 CCACCTGCCCTCTCCCAGAACTG No data
Right 1184981541 22:48099302-48099324 TGAAGAGCTGGCACCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184981534 Original CRISPR CAGTTCTGGGAGAGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr