ID: 1184982448

View in Genome Browser
Species Human (GRCh38)
Location 22:48104079-48104101
Sequence AAACGGACCAGGATGGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184982443_1184982448 -8 Left 1184982443 22:48104064-48104086 CCAAGTCATTGATAGAAACGGAC No data
Right 1184982448 22:48104079-48104101 AAACGGACCAGGATGGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184982448 Original CRISPR AAACGGACCAGGATGGGGAG TGG Intergenic