ID: 1184982754

View in Genome Browser
Species Human (GRCh38)
Location 22:48105832-48105854
Sequence CTGAAAGCAGGGAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184982754_1184982758 -8 Left 1184982754 22:48105832-48105854 CCCTCTGCTCTCCCTGCTTTCAG No data
Right 1184982758 22:48105847-48105869 GCTTTCAGCCCCTGAGTCTCTGG No data
1184982754_1184982759 -7 Left 1184982754 22:48105832-48105854 CCCTCTGCTCTCCCTGCTTTCAG No data
Right 1184982759 22:48105848-48105870 CTTTCAGCCCCTGAGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184982754 Original CRISPR CTGAAAGCAGGGAGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr