ID: 1184982903

View in Genome Browser
Species Human (GRCh38)
Location 22:48106905-48106927
Sequence TGGCAGGTATTGGACCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184982903_1184982922 29 Left 1184982903 22:48106905-48106927 CCCCCATGGTCCAATACCTGCCA No data
Right 1184982922 22:48106957-48106979 ATTTCAACATGAGACTTGGGTGG 0: 11
1: 308
2: 2938
3: 13328
4: 16081
1184982903_1184982911 0 Left 1184982903 22:48106905-48106927 CCCCCATGGTCCAATACCTGCCA No data
Right 1184982911 22:48106928-48106950 CTGCCCCCCCCCGCAACACTGGG No data
1184982903_1184982923 30 Left 1184982903 22:48106905-48106927 CCCCCATGGTCCAATACCTGCCA No data
Right 1184982923 22:48106958-48106980 TTTCAACATGAGACTTGGGTGGG 0: 8
1: 229
2: 1817
3: 12662
4: 15985
1184982903_1184982910 -1 Left 1184982903 22:48106905-48106927 CCCCCATGGTCCAATACCTGCCA No data
Right 1184982910 22:48106927-48106949 ACTGCCCCCCCCCGCAACACTGG No data
1184982903_1184982921 26 Left 1184982903 22:48106905-48106927 CCCCCATGGTCCAATACCTGCCA No data
Right 1184982921 22:48106954-48106976 TACATTTCAACATGAGACTTGGG 0: 16
1: 350
2: 2045
3: 10886
4: 12654
1184982903_1184982920 25 Left 1184982903 22:48106905-48106927 CCCCCATGGTCCAATACCTGCCA No data
Right 1184982920 22:48106953-48106975 ATACATTTCAACATGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184982903 Original CRISPR TGGCAGGTATTGGACCATGG GGG (reversed) Intergenic
No off target data available for this crispr