ID: 1184988192

View in Genome Browser
Species Human (GRCh38)
Location 22:48150098-48150120
Sequence ATCAGACATCATTCCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184988192_1184988198 5 Left 1184988192 22:48150098-48150120 CCCACTTTGGAATGATGTCTGAT No data
Right 1184988198 22:48150126-48150148 TCAAGTCTGTGTTTCCCGGGGGG No data
1184988192_1184988195 2 Left 1184988192 22:48150098-48150120 CCCACTTTGGAATGATGTCTGAT No data
Right 1184988195 22:48150123-48150145 TCTTCAAGTCTGTGTTTCCCGGG No data
1184988192_1184988194 1 Left 1184988192 22:48150098-48150120 CCCACTTTGGAATGATGTCTGAT No data
Right 1184988194 22:48150122-48150144 TTCTTCAAGTCTGTGTTTCCCGG No data
1184988192_1184988197 4 Left 1184988192 22:48150098-48150120 CCCACTTTGGAATGATGTCTGAT No data
Right 1184988197 22:48150125-48150147 TTCAAGTCTGTGTTTCCCGGGGG No data
1184988192_1184988196 3 Left 1184988192 22:48150098-48150120 CCCACTTTGGAATGATGTCTGAT No data
Right 1184988196 22:48150124-48150146 CTTCAAGTCTGTGTTTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184988192 Original CRISPR ATCAGACATCATTCCAAAGT GGG (reversed) Intergenic
No off target data available for this crispr