ID: 1184992757

View in Genome Browser
Species Human (GRCh38)
Location 22:48181938-48181960
Sequence AACCCCTAATCCATGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184992750_1184992757 8 Left 1184992750 22:48181907-48181929 CCAAGACCTTCATCAACACCCCT No data
Right 1184992757 22:48181938-48181960 AACCCCTAATCCATGGCTCAGGG No data
1184992748_1184992757 10 Left 1184992748 22:48181905-48181927 CCCCAAGACCTTCATCAACACCC No data
Right 1184992757 22:48181938-48181960 AACCCCTAATCCATGGCTCAGGG No data
1184992752_1184992757 -10 Left 1184992752 22:48181925-48181947 CCCCTAAAATCTGAACCCCTAAT No data
Right 1184992757 22:48181938-48181960 AACCCCTAATCCATGGCTCAGGG No data
1184992751_1184992757 2 Left 1184992751 22:48181913-48181935 CCTTCATCAACACCCCTAAAATC No data
Right 1184992757 22:48181938-48181960 AACCCCTAATCCATGGCTCAGGG No data
1184992747_1184992757 22 Left 1184992747 22:48181893-48181915 CCTCAGTGGATTCCCCAAGACCT No data
Right 1184992757 22:48181938-48181960 AACCCCTAATCCATGGCTCAGGG No data
1184992749_1184992757 9 Left 1184992749 22:48181906-48181928 CCCAAGACCTTCATCAACACCCC No data
Right 1184992757 22:48181938-48181960 AACCCCTAATCCATGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184992757 Original CRISPR AACCCCTAATCCATGGCTCA GGG Intergenic
No off target data available for this crispr