ID: 1184996017

View in Genome Browser
Species Human (GRCh38)
Location 22:48208167-48208189
Sequence TTACCGAATGGAGATCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184996017_1184996024 30 Left 1184996017 22:48208167-48208189 CCTGGATGATCTCCATTCGGTAA No data
Right 1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG No data
1184996017_1184996021 -10 Left 1184996017 22:48208167-48208189 CCTGGATGATCTCCATTCGGTAA No data
Right 1184996021 22:48208180-48208202 CATTCGGTAAAGCCTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184996017 Original CRISPR TTACCGAATGGAGATCATCC AGG (reversed) Intergenic
No off target data available for this crispr